Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910384464:

Variant ID: vg0910384464 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10384464
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.57, G: 0.43, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

ATTCTTGTCTCCATCTGTTTAACCTAAATCTCGTATATACCCTAGTACCAATGATACCCATACTGTCTAAATACCGTAGTCACGATATCAAATGTCGACA[G/C]
TGGCGCGCCAAGTAGGGGGATTTTGGTGCTTCAAGATTCCGGTTGAGATGAGTTCAAGAGATGGATTCTTCGACAACAAACTACTCGACGACTTCGGCTA

Reverse complement sequence

TAGCCGAAGTCGTCGAGTAGTTTGTTGTCGAAGAATCCATCTCTTGAACTCATCTCAACCGGAATCTTGAAGCACCAAAATCCCCCTACTTGGCGCGCCA[C/G]
TGTCGACATTTGATATCGTGACTACGGTATTTAGACAGTATGGGTATCATTGGTACTAGGGTATATACGAGATTTAGGTTAAACAGATGGAGACAAGAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	21.10%	16.30%	0.66%	61.93%	NA
All Indica	2759	1.70%	3.60%	0.94%	93.73%	NA
All Japonica	1512	59.10%	37.00%	0.07%	3.84%	NA
Aus	269	6.30%	5.20%	0.00%	88.48%	NA
Indica I	595	3.40%	8.60%	0.50%	87.56%	NA
Indica II	465	1.90%	2.20%	0.65%	95.27%	NA
Indica III	913	0.40%	1.00%	1.31%	97.26%	NA
Indica Intermediate	786	1.80%	3.80%	1.02%	93.38%	NA
Temperate Japonica	767	38.70%	60.00%	0.00%	1.30%	NA
Tropical Japonica	504	87.10%	6.20%	0.20%	6.55%	NA
Japonica Intermediate	241	65.10%	28.60%	0.00%	6.22%	NA
VI/Aromatic	96	11.50%	67.70%	1.04%	19.79%	NA
Intermediate	90	31.10%	36.70%	3.33%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910384464	G -> DEL	N	N	silent_mutation	Average:12.742; most accessible tissue: Callus, score: 53.181	N	N	N	N
vg0910384464	G -> C	LOC_Os09g16980.1	upstream_gene_variant ; 2614.0bp to feature; MODIFIER	silent_mutation	Average:12.742; most accessible tissue: Callus, score: 53.181	N	N	N	N
vg0910384464	G -> C	LOC_Os09g16990.1	downstream_gene_variant ; 1452.0bp to feature; MODIFIER	silent_mutation	Average:12.742; most accessible tissue: Callus, score: 53.181	N	N	N	N
vg0910384464	G -> C	LOC_Os09g16995.1	downstream_gene_variant ; 3652.0bp to feature; MODIFIER	silent_mutation	Average:12.742; most accessible tissue: Callus, score: 53.181	N	N	N	N
vg0910384464	G -> C	LOC_Os09g16980-LOC_Os09g16990	intergenic_region ; MODIFIER	silent_mutation	Average:12.742; most accessible tissue: Callus, score: 53.181	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910384464	NA	5.08E-16	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910384464	NA	7.01E-09	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910384464	NA	3.72E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910384464	NA	3.30E-12	mr1454	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910384464	NA	9.11E-24	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910384464	NA	3.08E-08	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910384464	4.61E-06	NA	mr1723	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910384464	NA	8.05E-11	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910384464	NA	1.08E-07	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910384464	NA	2.00E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251