Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910252196:

Variant ID: vg0910252196 (JBrowse)	Variation Type: INDEL
Chromosome: chr09	Position: 10252196
Reference Allele: T	Alternative Allele: C,TCTATCC
Primary Allele: T	Secondary Allele: TCTATCC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGAGCCGGCCATATCCATCCGCCCGTCCTTATCCATCCGCCTTATCCATCCATCCGACCGAGTCGCTCACGTCTCTCTCTCGCTCTTGCTCTCTCGCCTC[T/C,TCTATCC]
CTCTCTCGCCTCCCTCTATCCCTCTCTCTCTCTCTCTCTCGGCGGCCCGGCGGTGGCCCGTCGAGGTAGGCGTGGCGGTGGCTGGCAACGGCGCGCCCTC

Reverse complement sequence

GAGGGCGCGCCGTTGCCAGCCACCGCCACGCCTACCTCGACGGGCCACCGCCGGGCCGCCGAGAGAGAGAGAGAGAGAGGGATAGAGGGAGGCGAGAGAG[A/G,GGATAGA]
GAGGCGAGAGAGCAAGAGCGAGAGAGAGACGTGAGCGACTCGGTCGGATGGATGGATAAGGCGGATGGATAAGGACGGGCGGATGGATATGGCCGGCTCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of TCTATCC(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.40%	0.00%	0.70%	2.88%	C: 0.02%
All Indica	2759	94.50%	0.10%	0.80%	4.68%	NA
All Japonica	1512	99.60%	0.00%	0.20%	0.13%	C: 0.07%
Aus	269	98.50%	0.00%	1.12%	0.37%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	76.10%	0.00%	1.72%	22.15%	NA
Indica III	913	99.20%	0.10%	0.33%	0.33%	NA
Indica Intermediate	786	95.70%	0.10%	1.27%	2.93%	NA
Temperate Japonica	767	99.60%	0.00%	0.26%	0.13%	NA
Tropical Japonica	504	99.60%	0.00%	0.20%	0.00%	C: 0.20%
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	95.80%	0.00%	3.12%	1.04%	NA
Intermediate	90	94.40%	0.00%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910252196	T -> DEL	N	N	silent_mutation	Average:99.223; most accessible tissue: Zhenshan97 flower, score: 99.82	N	N	N	N
vg0910252196	T -> TCTATCC	LOC_Os09g16760.1	5_prime_UTR_variant ; 889.0bp to feature; MODIFIER	silent_mutation	Average:99.223; most accessible tissue: Zhenshan97 flower, score: 99.82	N	N	N	N
vg0910252196	T -> TCTATCC	LOC_Os09g16750.1	upstream_gene_variant ; 4701.0bp to feature; MODIFIER	silent_mutation	Average:99.223; most accessible tissue: Zhenshan97 flower, score: 99.82	N	N	N	N
vg0910252196	T -> TCTATCC	LOC_Os09g16770.1	downstream_gene_variant ; 4064.0bp to feature; MODIFIER	silent_mutation	Average:99.223; most accessible tissue: Zhenshan97 flower, score: 99.82	N	N	N	N
vg0910252196	T -> C	LOC_Os09g16760.1	5_prime_UTR_variant ; 892.0bp to feature; MODIFIER	silent_mutation	Average:99.223; most accessible tissue: Zhenshan97 flower, score: 99.82	N	N	N	N
vg0910252196	T -> C	LOC_Os09g16750.1	upstream_gene_variant ; 4700.0bp to feature; MODIFIER	silent_mutation	Average:99.223; most accessible tissue: Zhenshan97 flower, score: 99.82	N	N	N	N
vg0910252196	T -> C	LOC_Os09g16770.1	downstream_gene_variant ; 4065.0bp to feature; MODIFIER	silent_mutation	Average:99.223; most accessible tissue: Zhenshan97 flower, score: 99.82	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0910252196	T	C	0.16	0.11	0.07	0.08	0.08	0.11
vg0910252196	T	TCTAT*	1.9	1.4	1.2	1.48	1.62	1.76

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910252196	1.71E-06	1.71E-06	mr1674	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251