Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909812535:

Variant ID: vg0909812535 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9812535
Reference Allele: GAlternative Allele: C,T
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGATGAGTTTTTAAGGATTAAATTCGGTTCTATTATGGATGATTACACATTAAAAGATAAAGCCTCTACCACTGCTAACCAACCTCCTATAGATCAAAC[G/C,T]
GGTAGTAAAACCGATGGAGCGGTGCACACGGCCGGTCAGACCGTGATATAGCCGTCGGTCCGACCGGCCAAACGGCCGGTCAGACCGGATATCACCCCGG

Reverse complement sequence

CCGGGGTGATATCCGGTCTGACCGGCCGTTTGGCCGGTCGGACCGACGGCTATATCACGGTCTGACCGGCCGTGTGCACCGCTCCATCGGTTTTACTACC[C/G,A]
GTTTGATCTATAGGAGGTTGGTTAGCAGTGGTAGAGGCTTTATCTTTTAATGTGTAATCATCCATAATAGAACCGAATTTAATCCTTAAAAACTCATCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.70% 0.20% 1.69% 23.40% NA
All Indica  2759 64.80% 0.20% 2.57% 32.44% NA
All Japonica  1512 88.20% 0.00% 0.20% 11.64% NA
Aus  269 91.40% 0.70% 1.86% 5.95% NA
Indica I  595 36.60% 0.00% 3.19% 60.17% NA
Indica II  465 50.30% 0.60% 2.37% 46.67% NA
Indica III  913 89.20% 0.20% 1.31% 9.31% NA
Indica Intermediate  786 66.30% 0.10% 3.69% 29.90% NA
Temperate Japonica  767 86.20% 0.00% 0.26% 13.56% NA
Tropical Japonica  504 88.90% 0.00% 0.20% 10.91% NA
Japonica Intermediate  241 92.90% 0.00% 0.00% 7.05% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 78.90% 0.00% 1.11% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909812535 G -> DEL LOC_Os09g16080.1 N frameshift_variant Average:59.261; most accessible tissue: Minghui63 young leaf, score: 89.109 N N N N
vg0909812535 G -> T LOC_Os09g16080.1 synonymous_variant ; p.Thr138Thr; LOW N Average:59.261; most accessible tissue: Minghui63 young leaf, score: 89.109 N N N N
vg0909812535 G -> T LOC_Os09g16060.1 upstream_gene_variant ; 3462.0bp to feature; MODIFIER N Average:59.261; most accessible tissue: Minghui63 young leaf, score: 89.109 N N N N
vg0909812535 G -> T LOC_Os09g16070.1 downstream_gene_variant ; 2031.0bp to feature; MODIFIER N Average:59.261; most accessible tissue: Minghui63 young leaf, score: 89.109 N N N N
vg0909812535 G -> C LOC_Os09g16080.1 synonymous_variant ; p.Thr138Thr; LOW synonymous_codon Average:59.261; most accessible tissue: Minghui63 young leaf, score: 89.109 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0909812535 G C 0.0 -0.01 -0.01 0.0 -0.01 -0.01
vg0909812535 G T -0.02 -0.02 -0.01 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909812535 4.82E-06 NA mr1976 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251