Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909394179:

Variant ID: vg0909394179 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 9394179
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, A: 0.06, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:

GTAACACATATGGATGTTTGTTTTTTTCTTTTTTTTCTTTTCGGACAAATATTTGTTTATCATAGGAATAGGGCGTGCGTATTTGTATTCATAATGTGCG[T/A]
CCGCACGCATTTATATGAGCTCATGTGATTGCCTTTTAAATTGTTAGTAAAAAAAGTATTTTTAAAAATTTGACAGGAAGAGGGTGGAGCAACGGGTGGC

Reverse complement sequence

GCCACCCGTTGCTCCACCCTCTTCCTGTCAAATTTTTAAAAATACTTTTTTTACTAACAATTTAAAAGGCAATCACATGAGCTCATATAAATGCGTGCGG[A/T]
CGCACATTATGAATACAAATACGCACGCCCTATTCCTATGATAAACAAATATTTGTCCGAAAAGAAAAAAAAGAAAAAAACAAACATCCATATGTGTTAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.50%	17.80%	4.32%	39.36%	NA
All Indica	2759	12.30%	29.40%	3.12%	55.20%	NA
All Japonica	1512	71.80%	1.50%	6.75%	19.91%	NA
Aus	269	90.70%	0.00%	4.09%	5.20%	NA
Indica I	595	9.40%	27.60%	3.36%	59.66%	NA
Indica II	465	10.10%	21.10%	0.86%	67.96%	NA
Indica III	913	14.60%	39.10%	3.61%	42.72%	NA
Indica Intermediate	786	13.00%	24.60%	3.69%	58.78%	NA
Temperate Japonica	767	77.30%	1.40%	6.39%	14.86%	NA
Tropical Japonica	504	69.80%	1.00%	2.98%	26.19%	NA
Japonica Intermediate	241	58.50%	2.90%	15.77%	22.82%	NA
VI/Aromatic	96	95.80%	0.00%	0.00%	4.17%	NA
Intermediate	90	66.70%	7.80%	5.56%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0909394179	T -> DEL	N	N	silent_mutation	Average:14.85; most accessible tissue: Callus, score: 37.906	N	N	N	N
vg0909394179	T -> A	LOC_Os09g15360.1	upstream_gene_variant ; 2777.0bp to feature; MODIFIER	silent_mutation	Average:14.85; most accessible tissue: Callus, score: 37.906	N	N	N	N
vg0909394179	T -> A	LOC_Os09g15370.1	upstream_gene_variant ; 4933.0bp to feature; MODIFIER	silent_mutation	Average:14.85; most accessible tissue: Callus, score: 37.906	N	N	N	N
vg0909394179	T -> A	LOC_Os09g15365.1	downstream_gene_variant ; 3327.0bp to feature; MODIFIER	silent_mutation	Average:14.85; most accessible tissue: Callus, score: 37.906	N	N	N	N
vg0909394179	T -> A	LOC_Os09g15360-LOC_Os09g15365	intergenic_region ; MODIFIER	silent_mutation	Average:14.85; most accessible tissue: Callus, score: 37.906	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0909394179	3.19E-06	5.81E-09	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909394179	2.26E-06	1.54E-12	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909394179	NA	5.22E-06	mr1377_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909394179	3.44E-07	1.89E-06	mr1545_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909394179	2.40E-07	4.13E-15	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909394179	5.94E-06	1.04E-14	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251