Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909235018:

Variant ID: vg0909235018 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9235018
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGAGTGATGAACCCGTAATGATGAGAATATATCTTGCATAAATAATAAAAGTAAATACCAAGGAGATCACAAATACTTATCATCTCCAGCCCTCCTCC[G/A]
GAACACCCCTGGATGAATGTCGACATCTCCGGTGCTCCTCCGAACCACCCCCTCCCCCGAGAGAACTTCGACATTTGACACACTCCTTTCAGAGCTTCCC

Reverse complement sequence

GGGAAGCTCTGAAAGGAGTGTGTCAAATGTCGAAGTTCTCTCGGGGGAGGGGGTGGTTCGGAGGAGCACCGGAGATGTCGACATTCATCCAGGGGTGTTC[C/T]
GGAGGAGGGCTGGAGATGATAAGTATTTGTGATCTCCTTGGTATTTACTTTTATTATTTATGCAAGATATATTCTCATCATTACGGGTTCATCACTCTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.40% 4.60% 0.00% 0.00% NA
All Indica  2759 98.40% 1.60% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 36.40% 63.60% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 95.40% 4.60% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909235018 G -> A LOC_Os09g15220.1 upstream_gene_variant ; 3147.0bp to feature; MODIFIER silent_mutation Average:49.513; most accessible tissue: Zhenshan97 young leaf, score: 74.302 N N N N
vg0909235018 G -> A LOC_Os09g15200.1 downstream_gene_variant ; 3452.0bp to feature; MODIFIER silent_mutation Average:49.513; most accessible tissue: Zhenshan97 young leaf, score: 74.302 N N N N
vg0909235018 G -> A LOC_Os09g15210.1 downstream_gene_variant ; 420.0bp to feature; MODIFIER silent_mutation Average:49.513; most accessible tissue: Zhenshan97 young leaf, score: 74.302 N N N N
vg0909235018 G -> A LOC_Os09g15210-LOC_Os09g15220 intergenic_region ; MODIFIER silent_mutation Average:49.513; most accessible tissue: Zhenshan97 young leaf, score: 74.302 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909235018 NA 5.11E-14 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909235018 NA 4.12E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909235018 3.66E-06 NA mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909235018 1.94E-09 NA mr1550_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909235018 2.35E-06 NA mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251