| Variant ID: vg0909146176 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 9146176 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTGGAAAAAAAAACTTGTGATAAAAGAGATGAGAAAGAAAAAGATAGAAAATTATATGAAAAAGAATGGAAAACTTAGTTAATTTAAATTAAATTAAGT[A/T]
AAACAAATTTAATATTTGTTTACAACTTTAAAATGATGGGGAATGAAAACATGAATAATTTGTTGTATTATTTTATAATAATTATATATTGCTATTTTTA
TAAAAATAGCAATATATAATTATTATAAAATAATACAACAAATTATTCATGTTTTCATTCCCCATCATTTTAAAGTTGTAAACAAATATTAAATTTGTTT[T/A]
ACTTAATTTAATTTAAATTAACTAAGTTTTCCATTCTTTTTCATATAATTTTCTATCTTTTTCTTTCTCATCTCTTTTATCACAAGTTTTTTTTTCCAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.40% | 4.00% | 0.49% | 2.18% | NA |
| All Indica | 2759 | 98.70% | 1.20% | 0.04% | 0.04% | NA |
| All Japonica | 1512 | 96.40% | 0.00% | 0.79% | 2.84% | NA |
| Aus | 269 | 42.40% | 54.60% | 2.97% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.90% | 3.80% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 94.70% | 0.00% | 1.43% | 3.91% | NA |
| Tropical Japonica | 504 | 97.80% | 0.00% | 0.00% | 2.18% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 41.70% | 1.00% | 1.04% | 56.25% | NA |
| Intermediate | 90 | 87.80% | 5.60% | 1.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0909146176 | A -> DEL | N | N | silent_mutation | Average:14.955; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0909146176 | A -> T | LOC_Os09g15090.1 | upstream_gene_variant ; 357.0bp to feature; MODIFIER | silent_mutation | Average:14.955; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0909146176 | A -> T | LOC_Os09g15070-LOC_Os09g15090 | intergenic_region ; MODIFIER | silent_mutation | Average:14.955; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0909146176 | NA | 4.91E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909146176 | NA | 3.48E-21 | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909146176 | NA | 6.55E-06 | mr1393 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909146176 | NA | 9.66E-06 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909146176 | NA | 5.33E-07 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909146176 | NA | 2.29E-06 | mr1787 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909146176 | NA | 3.62E-11 | mr1193_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909146176 | NA | 5.03E-08 | mr1808_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909146176 | NA | 2.14E-06 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909146176 | NA | 2.62E-06 | mr1892_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |