Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909036057:

Variant ID: vg0909036057 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 9036057
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.25, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

TTATACCCGTTTCGCGAAACCGGGAACGGCCCAATGATGTCCTGTCCCCATCTGGCAAAGGGCCATATTGGCGCAATGGGCTGCAAATCATACTGGGGCG[T/C]
GGCTTGGCTTCGGCCATGACGCTGGCAACTTTCGCACTTCTTGATTTGCTCAACACAGACTTTCAACATAGTGGGCCAATAAACTCCTTGTCTAAATACT

Reverse complement sequence

AGTATTTAGACAAGGAGTTTATTGGCCCACTATGTTGAAAGTCTGTGTTGAGCAAATCAAGAAGTGCGAAAGTTGCCAGCGTCATGGCCGAAGCCAAGCC[A/G]
CGCCCCAGTATGATTTGCAGCCCATTGCGCCAATATGGCCCTTTGCCAGATGGGGACAGGACATCATTGGGCCGTTCCCGGTTTCGCGAAACGGGTATAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.00%	0.50%	6.37%	51.18%	NA
All Indica	2759	13.30%	0.60%	5.62%	80.50%	NA
All Japonica	1512	89.40%	0.30%	3.77%	6.61%	NA
Aus	269	61.30%	0.40%	23.42%	14.87%	NA
Indica I	595	9.60%	0.20%	5.04%	85.21%	NA
Indica II	465	6.90%	0.40%	4.09%	88.60%	NA
Indica III	913	17.90%	0.80%	6.57%	74.81%	NA
Indica Intermediate	786	14.50%	0.90%	5.85%	78.75%	NA
Temperate Japonica	767	94.00%	0.00%	1.83%	4.17%	NA
Tropical Japonica	504	92.30%	0.20%	2.18%	5.36%	NA
Japonica Intermediate	241	68.50%	1.20%	13.28%	17.01%	NA
VI/Aromatic	96	40.60%	1.00%	18.75%	39.58%	NA
Intermediate	90	68.90%	0.00%	8.89%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0909036057	T -> DEL	N	N	silent_mutation	Average:14.513; most accessible tissue: Zhenshan97 flag leaf, score: 19.61	N	N	N	N
vg0909036057	T -> C	LOC_Os09g15000.1	downstream_gene_variant ; 1344.0bp to feature; MODIFIER	silent_mutation	Average:14.513; most accessible tissue: Zhenshan97 flag leaf, score: 19.61	N	N	N	N
vg0909036057	T -> C	LOC_Os09g15010.1	intron_variant ; MODIFIER	silent_mutation	Average:14.513; most accessible tissue: Zhenshan97 flag leaf, score: 19.61	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0909036057	4.40E-06	NA	mr1280	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909036057	NA	2.25E-08	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909036057	NA	1.45E-06	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909036057	NA	8.53E-18	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909036057	NA	3.89E-09	mr1624	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909036057	NA	2.81E-12	mr1713	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909036057	NA	2.44E-06	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909036057	NA	3.43E-06	mr1807	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251