RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0908874352:

Variant ID: vg0908874352 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 8874352
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.58, A: 0.43, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

AAGCAAAACTTATGTAACGAACTTTACTAAGTCAAGCTTGTACTCATTAACAGTACTGTTAAAAACTGTCAGTGTTGTTTTTCTATCATTTAAGTTTGTT[A/G]
TGATCTGCTGTATGGAACATTTCTTGAAATCTGAGGAAATATTTTGAGTCATTACTACAAGAAAAATACTTTGTAGAGACATTTTTCTAGTACTGTAGAG

Reverse complement sequence

CTCTACAGTACTAGAAAAATGTCTCTACAAAGTATTTTTCTTGTAGTAATGACTCAAAATATTTCCTCAGATTTCAAGAAATGTTCCATACAGCAGATCA[T/C]
AACAAACTTAAATGATAGAAAAACAACACTGACAGTTTTTAACAGTACTGTTAATGAGTACAAGCTTGACTTAGTAAAGTTCGTTACATAAGTTTTGCTT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.80%	30.90%	0.08%	0.21%	NA
All Indica	2759	71.80%	27.70%	0.14%	0.33%	NA
All Japonica	1512	57.90%	42.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	90.60%	8.70%	0.34%	0.34%	NA
Indica II	465	35.70%	64.10%	0.00%	0.22%	NA
Indica III	913	78.50%	20.90%	0.11%	0.44%	NA
Indica Intermediate	786	71.10%	28.50%	0.13%	0.25%	NA
Temperate Japonica	767	26.30%	73.70%	0.00%	0.00%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	74.70%	25.30%	0.00%	0.00%	NA
VI/Aromatic	96	70.80%	28.10%	0.00%	1.04%	NA
Intermediate	90	65.60%	34.40%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0908874352	A -> G	LOC_Os09g14870.1	downstream_gene_variant ; 484.0bp to feature; MODIFIER	silent_mutation	Average:31.56; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0908874352	A -> G	LOC_Os09g14870-LOC_Os09g14880	intergenic_region ; MODIFIER	silent_mutation	Average:31.56; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0908874352	A -> DEL	N	N	silent_mutation	Average:31.56; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0908874352	NA	3.62E-11	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0908874352	NA	7.58E-06	mr1042	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352	NA	3.92E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352	NA	1.59E-06	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352	NA	1.42E-07	mr1271	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352	NA	2.04E-08	mr1295	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352	NA	2.16E-07	mr1410	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352	NA	4.02E-09	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352	NA	2.62E-08	mr1565	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908874352	NA	1.14E-08	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 21 entries

Previous1 2 3Next

Search for Variation information by Variation ID:

Detailed information for vg0908874352:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact