Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908658415:

Variant ID: vg0908658415 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 8658415
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 128. )

Flanking Sequence (100 bp) in Reference Genome:

ATAAATGTGCAGTGAAATCTTTATTCATACCTTTGCTGCCAGCCATACTCCTAGATTATATAAACAATATACAAATGTACGATGCAATTTTGATATCCTT[T/C]
GCTTAGCGTTTTCCAGAGATGAACCATGTAGTTTTCTGTCCAGAGCTTCTATATGCTAAGAGAATGAAACAAAATTGCATTGGTATCTGGTAACATATAT

Reverse complement sequence

ATATATGTTACCAGATACCAATGCAATTTTGTTTCATTCTCTTAGCATATAGAAGCTCTGGACAGAAAACTACATGGTTCATCTCTGGAAAACGCTAAGC[A/G]
AAGGATATCAAAATTGCATCGTACATTTGTATATTGTTTATATAATCTAGGAGTATGGCTGGCAGCAAAGGTATGAATAAAGATTTCACTGCACATTTAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.00%	34.10%	0.49%	12.38%	NA
All Indica	2759	47.60%	51.90%	0.51%	0.00%	NA
All Japonica	1512	54.40%	6.80%	0.40%	38.43%	NA
Aus	269	78.80%	20.40%	0.74%	0.00%	NA
Indica I	595	60.30%	38.80%	0.84%	0.00%	NA
Indica II	465	73.10%	26.90%	0.00%	0.00%	NA
Indica III	913	26.30%	73.50%	0.22%	0.00%	NA
Indica Intermediate	786	47.60%	51.50%	0.89%	0.00%	NA
Temperate Japonica	767	89.60%	0.00%	0.13%	10.30%	NA
Tropical Japonica	504	9.50%	7.10%	0.99%	82.34%	NA
Japonica Intermediate	241	36.10%	27.80%	0.00%	36.10%	NA
VI/Aromatic	96	95.80%	3.10%	1.04%	0.00%	NA
Intermediate	90	73.30%	22.20%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0908658415	T -> DEL	N	N	silent_mutation	Average:11.507; most accessible tissue: Zhenshan97 flag leaf, score: 21.009	N	N	N	N
vg0908658415	T -> C	LOC_Os09g14610.1	upstream_gene_variant ; 4438.0bp to feature; MODIFIER	silent_mutation	Average:11.507; most accessible tissue: Zhenshan97 flag leaf, score: 21.009	N	N	N	N
vg0908658415	T -> C	LOC_Os09g14610.2	upstream_gene_variant ; 3163.0bp to feature; MODIFIER	silent_mutation	Average:11.507; most accessible tissue: Zhenshan97 flag leaf, score: 21.009	N	N	N	N
vg0908658415	T -> C	LOC_Os09g14610-LOC_Os09g14614	intergenic_region ; MODIFIER	silent_mutation	Average:11.507; most accessible tissue: Zhenshan97 flag leaf, score: 21.009	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0908658415	NA	3.98E-07	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908658415	NA	4.01E-07	mr1115	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908658415	NA	5.44E-06	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908658415	NA	9.61E-06	mr1611	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908658415	NA	3.22E-07	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908658415	NA	9.07E-07	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908658415	NA	2.95E-06	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251