Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908619472:

Variant ID: vg0908619472 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 8619472
Reference Allele: A	Alternative Allele: C,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.14, A: 0.12, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

TCCATATATAAATCTATTCAAAATCTAAAACGTCTTGTAACGCGAAACAAAGCAAAAGTGGCTAGTACTCCCTCCGTCCCTAAATATTTGACGCCGTTGA[A/C,T]
CTTTTTTAAACATGTTTGACCGTTCATCTTATTCAAAAACTTTTGTGAAATATGTAAAACTATATGTATACATAAAAGTGTATTTAACAATGAATCAAAT

Reverse complement sequence

ATTTGATTCATTGTTAAATACACTTTTATGTATACATATAGTTTTACATATTTCACAAAAGTTTTTGAATAAGATGAACGGTCAAACATGTTTAAAAAAG[T/G,A]
TCAACGGCGTCAAATATTTAGGGACGGAGGGAGTACTAGCCACTTTTGCTTTGTTTCGCGTTACAAGACGTTTTAGATTTTGAATAGATTTATATATGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.90%	30.80%	0.30%	0.00%	T: 0.02%
All Indica	2759	75.80%	23.90%	0.29%	0.00%	NA
All Japonica	1512	54.10%	45.60%	0.33%	0.00%	NA
Aus	269	92.60%	7.40%	0.00%	0.00%	NA
Indica I	595	89.40%	10.30%	0.34%	0.00%	NA
Indica II	465	41.90%	57.80%	0.22%	0.00%	NA
Indica III	913	85.90%	14.10%	0.00%	0.00%	NA
Indica Intermediate	786	73.80%	25.60%	0.64%	0.00%	NA
Temperate Japonica	767	18.60%	80.70%	0.65%	0.00%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	75.10%	24.90%	0.00%	0.00%	NA
VI/Aromatic	96	49.00%	50.00%	0.00%	0.00%	T: 1.04%
Intermediate	90	55.60%	43.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0908619472	A -> T	LOC_Os09g14550.1	downstream_gene_variant ; 1361.0bp to feature; MODIFIER	silent_mutation	Average:25.974; most accessible tissue: Callus, score: 47.741	N	N	N	N
vg0908619472	A -> T	LOC_Os09g14560.1	downstream_gene_variant ; 4195.0bp to feature; MODIFIER	silent_mutation	Average:25.974; most accessible tissue: Callus, score: 47.741	N	N	N	N
vg0908619472	A -> T	LOC_Os09g14550-LOC_Os09g14560	intergenic_region ; MODIFIER	silent_mutation	Average:25.974; most accessible tissue: Callus, score: 47.741	N	N	N	N
vg0908619472	A -> C	LOC_Os09g14550.1	downstream_gene_variant ; 1361.0bp to feature; MODIFIER	silent_mutation	Average:25.974; most accessible tissue: Callus, score: 47.741	N	N	N	N
vg0908619472	A -> C	LOC_Os09g14560.1	downstream_gene_variant ; 4195.0bp to feature; MODIFIER	silent_mutation	Average:25.974; most accessible tissue: Callus, score: 47.741	N	N	N	N
vg0908619472	A -> C	LOC_Os09g14550-LOC_Os09g14560	intergenic_region ; MODIFIER	silent_mutation	Average:25.974; most accessible tissue: Callus, score: 47.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0908619472	NA	1.17E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472	NA	8.51E-06	mr1042	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472	NA	1.86E-06	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472	NA	3.12E-06	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472	NA	2.23E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472	NA	2.84E-06	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472	NA	6.10E-09	mr1271	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472	NA	4.47E-10	mr1295	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472	NA	1.84E-06	mr1295	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472	NA	3.21E-07	mr1482	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472	NA	9.46E-06	mr1565	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472	NA	7.64E-07	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472	NA	2.13E-06	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472	NA	9.21E-08	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472	NA	1.69E-10	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908619472	NA	4.49E-08	mr1861_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251