Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908550860:

Variant ID: vg0908550860 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 8550860
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCAGGCTATGTCTCTGGATCAATCAAACGGTCCCTTCTGCACTTGGCAAGCTGATGAAGGTAGTTGGACTTGGGTCTTCCAATGTGGTGCATAGGAGTG[G/C]
TGTCAAATCCAAGAGACTTGTAGAGTCGAACGGGATTCTCACGAGATCCTATCGGGAAATCATGAGAGGCCCTTCCAGCCCCACAACTGTGACCACCACC

Reverse complement sequence

GGTGGTGGTCACAGTTGTGGGGCTGGAAGGGCCTCTCATGATTTCCCGATAGGATCTCGTGAGAATCCCGTTCGACTCTACAAGTCTCTTGGATTTGACA[C/G]
CACTCCTATGCACCACATTGGAAGACCCAAGTCCAACTACCTTCATCAGCTTGCCAAGTGCAGAAGGGACCGTTTGATTGATCCAGAGACATAGCCTGAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.90%	6.40%	4.61%	23.11%	NA
All Indica	2759	49.40%	4.00%	7.61%	39.00%	NA
All Japonica	1512	99.30%	0.30%	0.20%	0.13%	NA
Aus	269	27.90%	67.30%	1.86%	2.97%	NA
Indica I	595	26.90%	0.20%	11.76%	61.18%	NA
Indica II	465	75.50%	1.50%	3.01%	20.00%	NA
Indica III	913	51.30%	5.70%	8.43%	34.61%	NA
Indica Intermediate	786	49.00%	6.20%	6.23%	38.55%	NA
Temperate Japonica	767	99.70%	0.10%	0.00%	0.13%	NA
Tropical Japonica	504	99.40%	0.40%	0.00%	0.20%	NA
Japonica Intermediate	241	97.90%	0.80%	1.24%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	87.80%	5.60%	0.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0908550860	G -> DEL	N	N	silent_mutation	Average:26.726; most accessible tissue: Minghui63 young leaf, score: 57.221	N	N	N	N
vg0908550860	G -> C	LOC_Os09g14460.1	upstream_gene_variant ; 161.0bp to feature; MODIFIER	silent_mutation	Average:26.726; most accessible tissue: Minghui63 young leaf, score: 57.221	N	N	N	N
vg0908550860	G -> C	LOC_Os09g14470.1	downstream_gene_variant ; 1418.0bp to feature; MODIFIER	silent_mutation	Average:26.726; most accessible tissue: Minghui63 young leaf, score: 57.221	N	N	N	N
vg0908550860	G -> C	LOC_Os09g14460-LOC_Os09g14470	intergenic_region ; MODIFIER	silent_mutation	Average:26.726; most accessible tissue: Minghui63 young leaf, score: 57.221	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0908550860	NA	1.08E-06	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908550860	NA	8.65E-07	mr1048	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908550860	NA	6.83E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908550860	NA	3.63E-06	mr1184	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908550860	NA	3.55E-07	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908550860	NA	2.65E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908550860	NA	3.70E-07	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908550860	NA	5.98E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908550860	NA	4.80E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908550860	2.03E-06	4.54E-08	mr1928	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908550860	NA	4.25E-06	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251