Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907938886:

Variant ID: vg0907938886 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 7938886
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.06, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAACTCAAAATCAACTCCAAATTTAAGGGCGTAAATTTAAAATTTGGCTGATAAGCATAAGCATAAGCATAAGCAAAAACATGAGGCTCAAAGTTGTG[G/A]
TTGGTTGAGAAGTGGAGATAGATGAGAAAATTGAATGATAAAGGGTTGTGGTTGGTTGAGAAGAAAATATTATTTTAGGATAAAACTTAAAGGCTAGAAG

Reverse complement sequence

CTTCTAGCCTTTAAGTTTTATCCTAAAATAATATTTTCTTCTCAACCAACCACAACCCTTTATCATTCAATTTTCTCATCTATCTCCACTTCTCAACCAA[C/T]
CACAACTTTGAGCCTCATGTTTTTGCTTATGCTTATGCTTATGCTTATCAGCCAAATTTTAAATTTACGCCCTTAAATTTGGAGTTGATTTTGAGTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.90%	32.00%	0.04%	0.00%	NA
All Indica	2759	91.40%	8.60%	0.04%	0.00%	NA
All Japonica	1512	25.50%	74.40%	0.07%	0.00%	NA
Aus	269	92.90%	7.10%	0.00%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	97.00%	3.00%	0.00%	0.00%	NA
Indica III	913	81.50%	18.40%	0.11%	0.00%	NA
Indica Intermediate	786	93.60%	6.40%	0.00%	0.00%	NA
Temperate Japonica	767	15.10%	84.70%	0.13%	0.00%	NA
Tropical Japonica	504	24.00%	76.00%	0.00%	0.00%	NA
Japonica Intermediate	241	61.80%	38.20%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	55.60%	44.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0907938886	G -> A	LOC_Os09g13630.1	upstream_gene_variant ; 725.0bp to feature; MODIFIER	silent_mutation	Average:54.567; most accessible tissue: Zhenshan97 flower, score: 64.273	N	N	N	N
vg0907938886	G -> A	LOC_Os09g13630-LOC_Os09g13640	intergenic_region ; MODIFIER	silent_mutation	Average:54.567; most accessible tissue: Zhenshan97 flower, score: 64.273	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0907938886	NA	1.03E-13	mr1239	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886	NA	1.30E-18	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886	5.59E-06	1.42E-06	mr1579	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886	NA	1.97E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886	NA	4.44E-13	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886	NA	2.34E-09	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886	NA	1.56E-19	mr1657_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886	NA	1.34E-09	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886	NA	6.61E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886	NA	8.56E-12	mr1756_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886	NA	4.84E-11	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886	NA	7.64E-07	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886	NA	8.50E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251