Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907838282:

Variant ID: vg0907838282 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 7838282
Reference Allele: TAlternative Allele: C,TAC
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


GGTGCTTCAAGGTTTCGATGAGATGGGTTTGAGATATGGACTCTCCAAGTACAAGCTACTCGGCGACTTCGGCTGTGGGGAGATCCAACCTATCCAAGTA[T/C,TAC]
ATCTTCTGACTAGATCGGAACCATCATCGTCATCGACAACTTGGTCTATCGAGATCATCCAAGCCTCAAGCTCCGCGACATACCAAAAGATGTCAGATCG

Reverse complement sequence

CGATCTGACATCTTTTGGTATGTCGCGGAGCTTGAGGCTTGGATGATCTCGATAGACCAAGTTGTCGATGACGATGATGGTTCCGATCTAGTCAGAAGAT[A/G,GTA]
TACTTGGATAGGTTGGATCTCCCCACAGCCGAAGTCGCCGAGTAGCTTGTACTTGGAGAGTCCATATCTCAAACCCATCTCATCGAAACCTTGAAGCACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.20% 11.40% 0.23% 0.00% TAC: 5.12%
All Indica  2759 90.40% 0.60% 0.33% 0.00% TAC: 8.66%
All Japonica  1512 66.30% 33.70% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.50% 1.00% 0.34% 0.00% TAC: 3.19%
Indica II  465 94.80% 0.20% 0.86% 0.00% TAC: 4.09%
Indica III  913 82.70% 0.00% 0.22% 0.00% TAC: 17.09%
Indica Intermediate  786 92.90% 1.30% 0.13% 0.00% TAC: 5.73%
Temperate Japonica  767 38.60% 61.40% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 85.10% 14.90% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 80.00% 14.40% 2.22% 0.00% TAC: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907838282 T -> C LOC_Os09g13520.1 missense_variant ; p.Tyr27His; MODERATE nonsynonymous_codon ; Y27H Average:37.22; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 benign -1.317 TOLERATED 0.99
vg0907838282 T -> TAC LOC_Os09g13520.1 frameshift_variant ; p.Leu28fs; HIGH frameshift_variant Average:37.22; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907838282 NA 1.96E-09 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 NA 2.33E-08 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 7.12E-06 7.13E-06 mr1166 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 1.15E-07 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 6.66E-07 NA mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 1.02E-08 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 1.25E-07 NA mr1305 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 NA 6.93E-07 mr1559 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 1.18E-08 NA mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 1.58E-07 NA mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 3.63E-08 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 4.87E-07 NA mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 9.55E-06 NA mr1687 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 4.79E-06 NA mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 9.35E-06 NA mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 NA 2.69E-11 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 NA 8.55E-09 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 NA 2.44E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 NA 1.18E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 NA 9.08E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 NA 5.74E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 NA 3.27E-07 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 NA 8.48E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 NA 1.31E-09 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 NA 6.28E-06 mr1550_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 NA 2.10E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 NA 5.49E-09 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 NA 2.50E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 NA 4.29E-11 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 NA 7.50E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 NA 9.73E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907838282 NA 7.54E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251