Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907678745:

Variant ID: vg0907678745 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 7678745
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.13, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTCAAATGGGAATATGGTCAACAACAAAGTTGATCCTCTCATCAAGATCTACAACTTTTATTTTGGTCACTTCTTCATCCGACAAAGTGATAGTTATA[T/C]
TATTCACAATAATCACATTTCTCTCATCTGGTTTATAAATATGAACACAGATATGTCAATTTTCTGTAAACATTGGTACTATCACTTTGTCGGATGAAGA

Reverse complement sequence

TCTTCATCCGACAAAGTGATAGTACCAATGTTTACAGAAAATTGACATATCTGTGTTCATATTTATAAACCAGATGAGAGAAATGTGATTATTGTGAATA[A/G]
TATAACTATCACTTTGTCGGATGAAGAAGTGACCAAAATAAAAGTTGTAGATCTTGATGAGAGGATCAACTTTGTTGTTGACCATATTCCCATTTGAAAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.00%	42.90%	11.07%	3.00%	NA
All Indica	2759	18.30%	63.50%	17.25%	0.91%	NA
All Japonica	1512	87.80%	2.60%	2.05%	7.61%	NA
Aus	269	17.10%	79.90%	2.97%	0.00%	NA
Indica I	595	17.10%	48.70%	32.44%	1.68%	NA
Indica II	465	10.50%	64.70%	22.58%	2.15%	NA
Indica III	913	21.90%	73.70%	4.38%	0.00%	NA
Indica Intermediate	786	19.70%	62.10%	17.56%	0.64%	NA
Temperate Japonica	767	78.40%	3.90%	3.26%	14.47%	NA
Tropical Japonica	504	98.60%	1.20%	0.20%	0.00%	NA
Japonica Intermediate	241	95.00%	1.20%	2.07%	1.66%	NA
VI/Aromatic	96	92.70%	6.20%	1.04%	0.00%	NA
Intermediate	90	71.10%	18.90%	7.78%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0907678745	T -> DEL	N	N	silent_mutation	Average:14.457; most accessible tissue: Callus, score: 37.283	N	N	N	N
vg0907678745	T -> C	LOC_Os09g13310.1	downstream_gene_variant ; 1668.0bp to feature; MODIFIER	silent_mutation	Average:14.457; most accessible tissue: Callus, score: 37.283	N	N	N	N
vg0907678745	T -> C	LOC_Os09g13320.1	downstream_gene_variant ; 1239.0bp to feature; MODIFIER	silent_mutation	Average:14.457; most accessible tissue: Callus, score: 37.283	N	N	N	N
vg0907678745	T -> C	LOC_Os09g13310-LOC_Os09g13320	intergenic_region ; MODIFIER	silent_mutation	Average:14.457; most accessible tissue: Callus, score: 37.283	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0907678745	NA	3.37E-09	mr1198	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907678745	NA	4.85E-15	mr1162_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907678745	4.32E-06	6.43E-06	mr1631_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907678745	NA	4.00E-07	mr1851_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907678745	NA	9.76E-06	mr1882_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251