Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907218440:

Variant ID: vg0907218440 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 7218440
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTAGACGAGGCGCTGTGCTTTCAGTGGTAGACGAAGCGAGGCGCATGTGGTGACTTTGTCAATCTCTCCAGGATTTGCCGATCCAGTCTTCGAAGATACT[C/A]
ATAAGGTTCATGGGGGTGAGTGCGCGTGCGCATGTGGTGACTTTGTCAATCTCTCCAGGATTTGCCGATCCAGTCTTCGAAGATACTCATAGGATTCATA

Reverse complement sequence

TATGAATCCTATGAGTATCTTCGAAGACTGGATCGGCAAATCCTGGAGAGATTGACAAAGTCACCACATGCGCACGCGCACTCACCCCCATGAACCTTAT[G/T]
AGTATCTTCGAAGACTGGATCGGCAAATCCTGGAGAGATTGACAAAGTCACCACATGCGCCTCGCTTCGTCTACCACTGAAAGCACAGCGCCTCGTCTAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.50%	1.00%	7.45%	54.10%	NA
All Indica	2759	9.40%	0.00%	6.85%	83.80%	NA
All Japonica	1512	89.80%	2.90%	6.48%	0.79%	NA
Aus	269	13.40%	0.00%	10.78%	75.84%	NA
Indica I	595	6.40%	0.00%	3.87%	89.75%	NA
Indica II	465	12.50%	0.00%	7.10%	80.43%	NA
Indica III	913	9.00%	0.00%	6.24%	84.78%	NA
Indica Intermediate	786	10.20%	0.00%	9.67%	80.15%	NA
Temperate Japonica	767	83.10%	5.30%	11.08%	0.52%	NA
Tropical Japonica	504	98.80%	0.00%	0.00%	1.19%	NA
Japonica Intermediate	241	92.50%	1.20%	5.39%	0.83%	NA
VI/Aromatic	96	64.60%	2.10%	29.17%	4.17%	NA
Intermediate	90	62.20%	1.10%	8.89%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0907218440	C -> DEL	N	N	silent_mutation	Average:62.551; most accessible tissue: Callus, score: 80.504	N	N	N	N
vg0907218440	C -> A	LOC_Os09g12580.1	upstream_gene_variant ; 1065.0bp to feature; MODIFIER	silent_mutation	Average:62.551; most accessible tissue: Callus, score: 80.504	N	N	N	N
vg0907218440	C -> A	LOC_Os09g12590.1	upstream_gene_variant ; 522.0bp to feature; MODIFIER	silent_mutation	Average:62.551; most accessible tissue: Callus, score: 80.504	N	N	N	N
vg0907218440	C -> A	LOC_Os09g12600.1	downstream_gene_variant ; 3735.0bp to feature; MODIFIER	silent_mutation	Average:62.551; most accessible tissue: Callus, score: 80.504	N	N	N	N
vg0907218440	C -> A	LOC_Os09g12600.2	downstream_gene_variant ; 3748.0bp to feature; MODIFIER	silent_mutation	Average:62.551; most accessible tissue: Callus, score: 80.504	N	N	N	N
vg0907218440	C -> A	LOC_Os09g12580-LOC_Os09g12590	intergenic_region ; MODIFIER	silent_mutation	Average:62.551; most accessible tissue: Callus, score: 80.504	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0907218440	NA	6.85E-06	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907218440	NA	4.32E-06	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907218440	1.02E-06	NA	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907218440	NA	2.10E-07	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907218440	3.62E-08	NA	mr1757_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907218440	NA	3.94E-08	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251