Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907162669:

Variant ID: vg0907162669 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 7162669
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.13, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

CTGTTCGGGTACGCAGTAGAGCCATATCTAGAAGCAGTGGGCTTGCCAGTGCCCGAAGTATCATGTTATGATTAAATTGAGCTTTGCATAGACAATGTTT[G/A]
AAATCCTCTCTACCCTTTGCCTATTTTTAGTTTGTGTGCTTGTATGAACCTGAAGAGGAGCTGAACACACACGTTCCCTACGGAAATCGATACATTGTAA

Reverse complement sequence

TTACAATGTATCGATTTCCGTAGGGAACGTGTGTGTTCAGCTCCTCTTCAGGTTCATACAAGCACACAAACTAAAAATAGGCAAAGGGTAGAGAGGATTT[C/T]
AAACATTGTCTATGCAAAGCTCAATTTAATCATAACATGATACTTCGGGCACTGGCAAGCCCACTGCTTCTAGATATGGCTCTACTGCGTACCCGAACAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.30%	49.30%	0.30%	0.06%	NA
All Indica	2759	78.60%	20.90%	0.36%	0.07%	NA
All Japonica	1512	0.70%	99.10%	0.13%	0.00%	NA
Aus	269	63.90%	36.10%	0.00%	0.00%	NA
Indica I	595	85.20%	14.60%	0.17%	0.00%	NA
Indica II	465	82.60%	17.40%	0.00%	0.00%	NA
Indica III	913	73.80%	26.00%	0.11%	0.11%	NA
Indica Intermediate	786	76.80%	22.00%	1.02%	0.13%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	98.60%	0.40%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	25.60%	71.10%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0907162669	G -> DEL	N	N	silent_mutation	Average:40.743; most accessible tissue: Zhenshan97 young leaf, score: 59.009	N	N	N	N
vg0907162669	G -> A	LOC_Os09g12500.1	upstream_gene_variant ; 3904.0bp to feature; MODIFIER	silent_mutation	Average:40.743; most accessible tissue: Zhenshan97 young leaf, score: 59.009	N	N	N	N
vg0907162669	G -> A	LOC_Os09g12500.2	upstream_gene_variant ; 3904.0bp to feature; MODIFIER	silent_mutation	Average:40.743; most accessible tissue: Zhenshan97 young leaf, score: 59.009	N	N	N	N
vg0907162669	G -> A	LOC_Os09g12490-LOC_Os09g12500	intergenic_region ; MODIFIER	silent_mutation	Average:40.743; most accessible tissue: Zhenshan97 young leaf, score: 59.009	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0907162669	NA	6.65E-08	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907162669	NA	4.76E-08	mr1450	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907162669	NA	1.89E-08	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907162669	NA	4.89E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251