Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906631032:

Variant ID: vg0906631032 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 6631032
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


GAACAGATTCTGGACGCTCTATAGTTTCAATGGCTCTCATTGACTCACATGGAATTTTGACGTGAGACTGGGCATATAGGAAAGGTAATCTTGCACTCTC[G/A]
TTAGCTTTCCATAAATATGTAGAACATCAAAAACATAGTCCGAATGAGTTATGGCCAACGATTTTAGTGTGGGCTTATGTATTTTGAGGTGGGCTCGAAC

Reverse complement sequence

GTTCGAGCCCACCTCAAAATACATAAGCCCACACTAAAATCGTTGGCCATAACTCATTCGGACTATGTTTTTGATGTTCTACATATTTATGGAAAGCTAA[C/T]
GAGAGTGCAAGATTACCTTTCCTATATGCCCAGTCTCACGTCAAAATTCCATGTGAGTCAATGAGAGCCATTGAAACTATAGAGCGTCCAGAATCTGTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.80% 6.20% 0.04% 0.00% NA
All Indica  2759 95.00% 4.90% 0.04% 0.00% NA
All Japonica  1512 89.70% 10.20% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 93.60% 6.20% 0.17% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 91.20% 8.80% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 2.20% 0.00% 0.00% NA
Temperate Japonica  767 84.70% 15.10% 0.13% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 87.60% 12.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906631032 G -> A LOC_Os09g11830.1 downstream_gene_variant ; 428.0bp to feature; MODIFIER silent_mutation Average:43.329; most accessible tissue: Zhenshan97 young leaf, score: 71.065 N N N N
vg0906631032 G -> A LOC_Os09g11820-LOC_Os09g11830 intergenic_region ; MODIFIER silent_mutation Average:43.329; most accessible tissue: Zhenshan97 young leaf, score: 71.065 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906631032 NA 5.17E-08 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 7.87E-07 NA mr1298_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 NA 1.69E-07 mr1298_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 1.39E-06 9.40E-09 mr1302_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 5.25E-07 5.25E-07 mr1302_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 1.17E-07 1.17E-09 mr1318_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 NA 3.15E-08 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 1.84E-06 NA mr1566_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 3.88E-06 3.88E-06 mr1604_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 NA 1.10E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 5.45E-06 6.06E-09 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 NA 4.44E-08 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 NA 2.45E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 NA 5.68E-06 mr1707_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 4.19E-06 1.33E-06 mr1729_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 NA 3.00E-06 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 2.20E-06 NA mr1731_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 NA 3.85E-07 mr1731_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 NA 1.12E-06 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 1.63E-06 NA mr1741_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 5.61E-06 NA mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 2.78E-07 2.39E-09 mr1788_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 NA 4.71E-08 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 8.39E-06 1.26E-06 mr1813_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 NA 6.25E-07 mr1813_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 NA 4.98E-06 mr1894_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 7.70E-06 NA mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906631032 NA 7.19E-06 mr1924_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251