Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906624349:

Variant ID: vg0906624349 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 6624349
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.11, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

GAGAAAAAGAAAAAAGAGTCCAAGTAGAAATACAATCTAAAATTAGCTAAAATTCGGAATTAAAAGAAAGCAATATTGAAAGAAGAGTCCATATAGGAAC[T/C]
TAATATGAGATTAACAAAATTCAGAATAAAAATAAAATAAAATCCAAAATTAGGCAAATTATAAATAACTAAAATTGGTGATAAAAATTAAAGACTATTG

Reverse complement sequence

CAATAGTCTTTAATTTTTATCACCAATTTTAGTTATTTATAATTTGCCTAATTTTGGATTTTATTTTATTTTTATTCTGAATTTTGTTAATCTCATATTA[A/G]
GTTCCTATATGGACTCTTCTTTCAATATTGCTTTCTTTTAATTCCGAATTTTAGCTAATTTTAGATTGTATTTCTACTTGGACTCTTTTTTCTTTTTCTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.70%	34.40%	0.40%	2.50%	NA
All Indica	2759	84.10%	14.20%	0.36%	1.30%	NA
All Japonica	1512	23.10%	76.70%	0.20%	0.00%	NA
Aus	269	63.90%	4.50%	1.86%	29.74%	NA
Indica I	595	96.30%	3.00%	0.67%	0.00%	NA
Indica II	465	63.20%	35.50%	0.22%	1.08%	NA
Indica III	913	91.90%	6.50%	0.11%	1.53%	NA
Indica Intermediate	786	78.10%	19.20%	0.51%	2.16%	NA
Temperate Japonica	767	18.90%	80.80%	0.26%	0.00%	NA
Tropical Japonica	504	14.10%	85.90%	0.00%	0.00%	NA
Japonica Intermediate	241	55.20%	44.40%	0.41%	0.00%	NA
VI/Aromatic	96	78.10%	20.80%	0.00%	1.04%	NA
Intermediate	90	51.10%	46.70%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0906624349	T -> DEL	N	N	silent_mutation	Average:30.697; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg0906624349	T -> C	LOC_Os09g11820-LOC_Os09g11830	intergenic_region ; MODIFIER	silent_mutation	Average:30.697; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0906624349	NA	1.52E-07	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	NA	6.06E-07	mr1051_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	NA	1.69E-07	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	NA	2.34E-08	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	NA	6.86E-06	mr1298_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	NA	8.02E-09	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	5.37E-06	5.37E-06	mr1302_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	NA	3.11E-07	mr1318_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	NA	1.15E-07	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	NA	5.87E-06	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	NA	3.37E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	NA	1.17E-07	mr1531_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	3.75E-06	3.75E-06	mr1604_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	NA	1.87E-07	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	NA	8.52E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	NA	5.32E-08	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	NA	3.50E-10	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	NA	3.13E-06	mr1705_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	NA	3.69E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	NA	6.98E-07	mr1729_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	NA	2.95E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	NA	4.18E-09	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	NA	3.26E-06	mr1813_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	NA	2.63E-07	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	NA	1.28E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906624349	NA	1.98E-06	mr1894_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251