Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906503067:

Variant ID: vg0906503067 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 6503067
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, T: 0.09, A: 0.01, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:

CTTATATAGGGGAAGGAGTCCGTATTACAAAATACAACACATATCCCTAACGGAATATGTGATTACAGATAAAATACAATCGTAACCGACTAGGATCCTG[G/T,A]
GTATTTCCTTGATATACGAGTTTAGAAACTAACCCGAATCCTCATAAAGGTATTCTATCTATATTTGGTACCCTGTACCCAACTAAACTATAACTGCCGT

Reverse complement sequence

ACGGCAGTTATAGTTTAGTTGGGTACAGGGTACCAAATATAGATAGAATACCTTTATGAGGATTCGGGTTAGTTTCTAAACTCGTATATCAAGGAAATAC[C/A,T]
CAGGATCCTAGTCGGTTACGATTGTATTTTATCTGTAATCACATATTCCGTTAGGGATATGTGTTGTATTTTGTAATACGGACTCCTTCCCCTATATAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.00%	6.70%	1.48%	43.74%	A: 0.04%
All Indica	2759	17.70%	9.10%	1.85%	71.40%	A: 0.04%
All Japonica	1512	95.20%	3.00%	0.13%	1.65%	NA
Aus	269	80.70%	6.30%	1.49%	11.52%	NA
Indica I	595	8.70%	20.70%	0.17%	70.42%	NA
Indica II	465	26.20%	0.60%	3.01%	70.11%	NA
Indica III	913	15.00%	4.90%	2.08%	77.98%	NA
Indica Intermediate	786	22.40%	10.10%	2.16%	65.27%	A: 0.13%
Temperate Japonica	767	98.20%	1.30%	0.13%	0.39%	NA
Tropical Japonica	504	97.40%	1.80%	0.00%	0.79%	NA
Japonica Intermediate	241	80.90%	11.20%	0.41%	7.47%	NA
VI/Aromatic	96	72.90%	0.00%	9.38%	16.67%	A: 1.04%
Intermediate	90	61.10%	6.70%	4.44%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0906503067	G -> DEL	N	N	silent_mutation	Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0906503067	G -> T	LOC_Os09g11640.1	upstream_gene_variant ; 2405.0bp to feature; MODIFIER	silent_mutation	Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0906503067	G -> T	LOC_Os09g11650.1	upstream_gene_variant ; 360.0bp to feature; MODIFIER	silent_mutation	Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0906503067	G -> T	LOC_Os09g11660.1	downstream_gene_variant ; 148.0bp to feature; MODIFIER	silent_mutation	Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0906503067	G -> T	LOC_Os09g11650-LOC_Os09g11660	intergenic_region ; MODIFIER	silent_mutation	Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0906503067	G -> A	LOC_Os09g11640.1	upstream_gene_variant ; 2405.0bp to feature; MODIFIER	silent_mutation	Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0906503067	G -> A	LOC_Os09g11650.1	upstream_gene_variant ; 360.0bp to feature; MODIFIER	silent_mutation	Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0906503067	G -> A	LOC_Os09g11660.1	downstream_gene_variant ; 148.0bp to feature; MODIFIER	silent_mutation	Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0906503067	G -> A	LOC_Os09g11650-LOC_Os09g11660	intergenic_region ; MODIFIER	silent_mutation	Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0906503067	2.69E-06	2.69E-06	mr1312_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906503067	NA	1.21E-06	mr1417_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906503067	NA	5.44E-06	mr1683_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906503067	5.76E-06	5.76E-06	mr1812_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906503067	4.17E-06	4.17E-06	mr1833_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251