Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906314868:

Variant ID: vg0906314868 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 6314868
Reference Allele: G	Alternative Allele: A,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.09, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

TCTGCCGTTGCTAATGGATGATTACGTCTTCTCCTCCGGTTGCTTCCGTCATTGCTGACTTGTTATTTCGCCCTCACGGTTGACCTACTTTGCAAACGCT[G/A,C]
ATGAGCGTCTTCGTCATTATCATCAGTTGCTACACTGCTATTGACTGGATCACCGACATCGTCATCTTCATCAATATCCTGTCAAGCCTCTTCAACATAG

Reverse complement sequence

CTATGTTGAAGAGGCTTGACAGGATATTGATGAAGATGACGATGTCGGTGATCCAGTCAATAGCAGTGTAGCAACTGATGATAATGACGAAGACGCTCAT[C/T,G]
AGCGTTTGCAAAGTAGGTCAACCGTGAGGGCGAAATAACAAGTCAGCAATGACGGAAGCAACCGGAGGAGAAGACGTAATCATCCATTAGCAACGGCAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.40%	30.40%	1.04%	6.07%	C: 0.08%
All Indica	2759	45.10%	50.00%	0.94%	3.84%	C: 0.14%
All Japonica	1512	84.90%	2.70%	1.32%	11.04%	NA
Aus	269	94.40%	0.70%	0.37%	4.46%	NA
Indica I	595	27.20%	66.70%	0.50%	5.21%	C: 0.34%
Indica II	465	69.20%	30.10%	0.43%	0.22%	NA
Indica III	913	38.10%	57.20%	0.88%	3.61%	C: 0.22%
Indica Intermediate	786	52.40%	40.70%	1.65%	5.22%	NA
Temperate Japonica	767	93.60%	1.30%	0.52%	4.56%	NA
Tropical Japonica	504	85.50%	1.40%	1.98%	11.11%	NA
Japonica Intermediate	241	56.00%	10.00%	2.49%	31.54%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	77.80%	17.80%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0906314868	G -> DEL	N	N	silent_mutation	Average:31.147; most accessible tissue: Minghui63 flag leaf, score: 51.386	N	N	N	N
vg0906314868	G -> C	LOC_Os09g11360.1	upstream_gene_variant ; 3735.0bp to feature; MODIFIER	silent_mutation	Average:31.147; most accessible tissue: Minghui63 flag leaf, score: 51.386	N	N	N	N
vg0906314868	G -> C	LOC_Os09g11360-LOC_Os09g11370	intergenic_region ; MODIFIER	silent_mutation	Average:31.147; most accessible tissue: Minghui63 flag leaf, score: 51.386	N	N	N	N
vg0906314868	G -> A	LOC_Os09g11360.1	upstream_gene_variant ; 3735.0bp to feature; MODIFIER	silent_mutation	Average:31.147; most accessible tissue: Minghui63 flag leaf, score: 51.386	N	N	N	N
vg0906314868	G -> A	LOC_Os09g11360-LOC_Os09g11370	intergenic_region ; MODIFIER	silent_mutation	Average:31.147; most accessible tissue: Minghui63 flag leaf, score: 51.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0906314868	NA	7.56E-06	mr1308	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906314868	3.34E-06	NA	mr1160_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906314868	8.23E-07	6.86E-08	mr1160_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251