Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906170235:

Variant ID: vg0906170235 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 6170235
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.03, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

GCACCCTAGGACCCTCATCTGGTCCTCTACGTCGACTTTTCTTTGGGCTTCCAACATGTTTGTCAAACTTTGGTGGATCAATATCATATCAGGTGAATCT[A/G]
TTTTTGTCCAGCTATGCTCATCAGGGACTAGATAGATAACTGCAGTATATGTTCTCATATAAGCATCCTTCCTAAAATAATCAGCGACATAATCTTCGGG

Reverse complement sequence

CCCGAAGATTATGTCGCTGATTATTTTAGGAAGGATGCTTATATGAGAACATATACTGCAGTTATCTATCTAGTCCCTGATGAGCATAGCTGGACAAAAA[T/C]
AGATTCACCTGATATGATATTGATCCACCAAAGTTTGACAAACATGTTGGAAGCCCAAAGAAAAGTCGACGTAGAGGACCAGATGAGGGTCCTAGGGTGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.40%	2.50%	14.79%	11.32%	NA
All Indica	2759	56.40%	3.90%	20.80%	18.96%	NA
All Japonica	1512	99.50%	0.20%	0.00%	0.26%	NA
Aus	269	52.00%	3.30%	43.87%	0.74%	NA
Indica I	595	41.20%	2.70%	28.07%	28.07%	NA
Indica II	465	77.40%	0.90%	7.96%	13.76%	NA
Indica III	913	50.70%	6.90%	24.75%	17.63%	NA
Indica Intermediate	786	62.00%	3.10%	18.32%	16.67%	NA
Temperate Japonica	767	99.50%	0.40%	0.00%	0.13%	NA
Tropical Japonica	504	99.60%	0.00%	0.00%	0.40%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	96.90%	0.00%	2.08%	1.04%	NA
Intermediate	90	88.90%	0.00%	5.56%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0906170235	A -> G	LOC_Os09g11120.1	upstream_gene_variant ; 3973.0bp to feature; MODIFIER	silent_mutation	Average:44.511; most accessible tissue: Callus, score: 70.526	N	N	N	N
vg0906170235	A -> G	LOC_Os09g11130.1	downstream_gene_variant ; 1379.0bp to feature; MODIFIER	silent_mutation	Average:44.511; most accessible tissue: Callus, score: 70.526	N	N	N	N
vg0906170235	A -> G	LOC_Os09g11140.1	downstream_gene_variant ; 884.0bp to feature; MODIFIER	silent_mutation	Average:44.511; most accessible tissue: Callus, score: 70.526	N	N	N	N
vg0906170235	A -> G	LOC_Os09g11130-LOC_Os09g11140	intergenic_region ; MODIFIER	silent_mutation	Average:44.511; most accessible tissue: Callus, score: 70.526	N	N	N	N
vg0906170235	A -> DEL	N	N	silent_mutation	Average:44.511; most accessible tissue: Callus, score: 70.526	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0906170235	3.24E-06	NA	mr1231	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906170235	2.57E-07	1.37E-07	mr1231	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906170235	NA	9.07E-06	mr1232	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906170235	5.32E-06	4.37E-07	mr1696	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251