Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0905947134:

Variant ID: vg0905947134 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 5947134
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 130. )

Flanking Sequence (100 bp) in Reference Genome:

CGAGGCGTCGGATATTTCATTATGCTTGTTTGATGACTTGAATTATTCACTTCATCTCTCAAATATAGTGTTAATCTCTCAAATATAGTGGAAGGTCCGG[A/G]
GAGCCTATGATTGGACTTTTTCGGAAAATTTCAAATTTAGAATATTTGGAATTTTAAGAGGATTTAGGCAAATAAGAATTGAATAGGAACATTTTGGATT

Reverse complement sequence

AATCCAAAATGTTCCTATTCAATTCTTATTTGCCTAAATCCTCTTAAAATTCCAAATATTCTAAATTTGAAATTTTCCGAAAAAGTCCAATCATAGGCTC[T/C]
CCGGACCTTCCACTATATTTGAGAGATTAACACTATATTTGAGAGATGAAGTGAATAATTCAAGTCATCAAACAAGCATAATGAAATATCCGACGCCTCG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.50%	10.80%	0.28%	5.44%	NA
All Indica	2759	81.20%	18.00%	0.29%	0.51%	NA
All Japonica	1512	83.40%	0.30%	0.33%	15.94%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	52.90%	46.70%	0.34%	0.00%	NA
Indica II	465	91.20%	8.40%	0.43%	0.00%	NA
Indica III	913	93.60%	5.70%	0.33%	0.33%	NA
Indica Intermediate	786	82.30%	16.20%	0.13%	1.40%	NA
Temperate Japonica	767	91.00%	0.00%	0.13%	8.87%	NA
Tropical Japonica	504	84.50%	1.00%	0.40%	14.09%	NA
Japonica Intermediate	241	56.80%	0.00%	0.83%	42.32%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	5.60%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0905947134	A -> G	LOC_Os09g10860.1	upstream_gene_variant ; 3287.0bp to feature; MODIFIER	silent_mutation	Average:32.801; most accessible tissue: Callus, score: 39.971	N	N	N	N
vg0905947134	A -> G	LOC_Os09g10865.1	upstream_gene_variant ; 3828.0bp to feature; MODIFIER	silent_mutation	Average:32.801; most accessible tissue: Callus, score: 39.971	N	N	N	N
vg0905947134	A -> G	LOC_Os09g10860-LOC_Os09g10865	intergenic_region ; MODIFIER	silent_mutation	Average:32.801; most accessible tissue: Callus, score: 39.971	N	N	N	N
vg0905947134	A -> DEL	N	N	silent_mutation	Average:32.801; most accessible tissue: Callus, score: 39.971	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0905947134	NA	8.44E-06	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905947134	4.07E-06	NA	mr1620	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251