Search for Variation information by Variation ID:
Detailed information for vg0905711629:
| Variant ID: vg0905711629 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 5711629 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
TGTCGCGATGCATAGGCCACAACCTTTCCGTCCTGCATCAGTACTCCTCCTAGTCCTTGCCTTGATGCATCACAATATATAACAAAGTCTTTCCTATTGT[T/C]
GGGGAGAACTAGAATAGGCGCAGAGGTCAGCTTTTCTTTGAGCTGCTCAAAACTTTCCTGGCACTGTTCTGACCACACAAACTTCTTTTCCTTCTGGAGT
Reverse complement sequence
ACTCCAGAAGGAAAAGAAGTTTGTGTGGTCAGAACAGTGCCAGGAAAGTTTTGAGCAGCTCAAAGAAAAGCTGACCTCTGCGCCTATTCTAGTTCTCCCC[A/G]
ACAATAGGAAAGACTTTGTTATATATTGTGATGCATCAAGGCAAGGACTAGGAGGAGTACTGATGCAGGACGGAAAGGTTGTGGCCTATGCATCGCGACA
Allele Frequencies:
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.30% | 1.90% | 22.83% | 40.92% | NA |
| All Indica | 2759 | 10.30% | 2.90% | 32.48% | 54.37% | NA |
| All Japonica | 1512 | 81.70% | 0.20% | 0.53% | 17.53% | NA |
| Aus | 269 | 13.80% | 2.60% | 57.99% | 25.65% | NA |
| Indica I | 595 | 21.50% | 1.00% | 18.15% | 59.33% | NA |
| Indica II | 465 | 10.80% | 1.30% | 26.67% | 61.29% | NA |
| Indica III | 913 | 3.30% | 4.60% | 48.52% | 43.59% | NA |
| Indica Intermediate | 786 | 9.70% | 3.20% | 28.12% | 59.03% | NA |
| Temperate Japonica | 767 | 90.90% | 0.00% | 0.26% | 8.87% | NA |
| Tropical Japonica | 504 | 82.10% | 0.40% | 0.20% | 17.26% | NA |
| Japonica Intermediate | 241 | 51.90% | 0.40% | 2.07% | 45.64% | NA |
| VI/Aromatic | 96 | 18.80% | 0.00% | 12.50% | 68.75% | NA |
| Intermediate | 90 | 51.10% | 3.30% | 7.78% | 37.78% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0905711629 | T -> DEL | LOC_Os09g10450.1 | N | frameshift_variant | Average:8.172; most accessible tissue: Callus, score: 20.744 | N | N | N | N |
| vg0905711629 | T -> C | LOC_Os09g10450.1 | missense_variant ; p.Asn310Asp; MODERATE | nonsynonymous_codon | Average:8.172; most accessible tissue: Callus, score: 20.744 | benign  |
-0.407 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0905711629 | 3.23E-06 | NA | mr1007 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905711629 | NA | 8.17E-14 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905711629 | NA | 3.97E-22 | mr1163 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905711629 | NA | 9.44E-10 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905711629 | NA | 6.90E-32 | mr1448 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905711629 | NA | 3.57E-09 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905711629 | NA | 2.99E-09 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905711629 | NA | 2.87E-10 | mr1905 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905711629 | NA | 3.82E-11 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |