Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0905685207:

Variant ID: vg0905685207 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 5685207
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAGCACAAGCATAGCAAGCGAGAACATTATGGCCAAGCTCATATTGGGATGATCTTCGGCTCCGACTCCGAGTCAAGTTCAAGTGATGAAGAAGGAGTC[G/A]
CCACGTTCGCCGTCAAGCCTTCATCACCACCGAGGCTCTTCGATTACTCAAGTGATGAGGATGCTCCCATTTGCCTCATGGCAAAGGAGCCCAAGGTACC

Reverse complement sequence

GGTACCTTGGGCTCCTTTGCCATGAGGCAAATGGGAGCATCCTCATCACTTGAGTAATCGAAGAGCCTCGGTGGTGATGAAGGCTTGACGGCGAACGTGG[C/T]
GACTCCTTCTTCATCACTTGAACTTGACTCGGAGTCGGAGCCGAAGATCATCCCAATATGAGCTTGGCCATAATGTTCTCGCTTGCTATGCTTGTGCTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.30% 8.60% 1.59% 10.52% NA
All Indica  2759 89.50% 0.30% 1.56% 8.63% NA
All Japonica  1512 60.40% 25.00% 1.12% 13.49% NA
Aus  269 97.80% 0.00% 0.74% 1.49% NA
Indica I  595 82.20% 0.30% 4.37% 13.11% NA
Indica II  465 90.50% 0.20% 1.08% 8.17% NA
Indica III  913 97.40% 0.30% 0.00% 2.30% NA
Indica Intermediate  786 85.40% 0.30% 1.53% 12.85% NA
Temperate Japonica  767 90.00% 1.40% 1.04% 7.56% NA
Tropical Japonica  504 22.60% 68.50% 1.39% 7.54% NA
Japonica Intermediate  241 45.20% 9.10% 0.83% 44.81% NA
VI/Aromatic  96 43.80% 2.10% 8.33% 45.83% NA
Intermediate  90 67.80% 18.90% 5.56% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0905685207 G -> DEL LOC_Os09g10390.1 N frameshift_variant Average:20.267; most accessible tissue: Callus, score: 65.408 N N N N
vg0905685207 G -> A LOC_Os09g10390.1 missense_variant ; p.Ala358Thr; MODERATE nonsynonymous_codon ; A358T Average:20.267; most accessible tissue: Callus, score: 65.408 possibly damaging 1.571 DELETERIOUS 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0905685207 NA 1.33E-09 mr1089 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 5.35E-11 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 3.48E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 3.24E-11 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 6.39E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 2.03E-06 3.25E-25 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 2.04E-16 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 7.60E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 1.40E-10 1.31E-22 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 1.07E-06 3.48E-18 mr1410 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 1.44E-11 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 2.05E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 1.07E-12 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 1.77E-09 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 5.83E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 6.66E-06 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 4.18E-08 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 1.42E-11 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 2.71E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 1.10E-06 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 3.87E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 1.05E-08 1.99E-27 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 1.08E-18 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 2.81E-09 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 1.03E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 6.01E-10 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 8.58E-07 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 1.75E-12 3.09E-24 mr1410_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 2.89E-07 7.33E-18 mr1410_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 9.26E-08 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 1.25E-06 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 1.29E-10 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 6.32E-09 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 3.32E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 2.92E-09 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 5.90E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 2.32E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 5.66E-11 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 3.29E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 7.69E-13 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905685207 NA 4.52E-15 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251