Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0905616909:

Variant ID: vg0905616909 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 5616909
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


GAGATATTTCGTACCTATGTACCACATAAGGTTAGGGCTCGAATCTTAATATTAAATCATGACAATTAGTATAAGCACAAATGGGTATGTTTACCATTCA[G/T]
TGTTCAAAGCATGTGCCCCTACCACAAAAACTTAGGTTTGTTTACCTATCTGCTACCCTAAGTCATCTCGGGTCCACATTAACTATAATCTTCTTAGGCT

Reverse complement sequence

AGCCTAAGAAGATTATAGTTAATGTGGACCCGAGATGACTTAGGGTAGCAGATAGGTAAACAAACCTAAGTTTTTGTGGTAGGGGCACATGCTTTGAACA[C/A]
TGAATGGTAAACATACCCATTTGTGCTTATACTAATTGTCATGATTTAATATTAAGATTCGAGCCCTAACCTTATGTGGTACATAGGTACGAAATATCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.10% 10.00% 0.85% 0.00% NA
All Indica  2759 99.50% 0.40% 0.04% 0.00% NA
All Japonica  1512 68.10% 29.60% 2.31% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.60% 0.13% 0.00% NA
Temperate Japonica  767 93.70% 3.50% 2.74% 0.00% NA
Tropical Japonica  504 23.80% 73.80% 2.38% 0.00% NA
Japonica Intermediate  241 79.30% 19.90% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 15.60% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0905616909 G -> T LOC_Os09g10310.1 downstream_gene_variant ; 3996.0bp to feature; MODIFIER silent_mutation Average:41.71; most accessible tissue: Minghui63 root, score: 59.105 N N N N
vg0905616909 G -> T LOC_Os09g10300-LOC_Os09g10310 intergenic_region ; MODIFIER silent_mutation Average:41.71; most accessible tissue: Minghui63 root, score: 59.105 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0905616909 NA 5.54E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 8.24E-10 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 3.02E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 9.93E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 4.20E-08 2.36E-26 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 7.17E-18 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 3.07E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 2.69E-11 1.87E-23 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 3.24E-06 2.48E-18 mr1410 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 1.24E-10 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 8.02E-10 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 8.86E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 1.55E-30 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 3.98E-16 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 5.28E-13 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 1.68E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 3.83E-14 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 3.85E-11 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 2.38E-12 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 3.34E-13 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 2.74E-10 3.00E-29 mr1301_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 5.67E-06 1.22E-20 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 2.02E-11 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 4.83E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 1.50E-11 4.10E-24 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 3.00E-06 4.18E-18 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 2.44E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 7.62E-12 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 5.40E-07 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 5.24E-10 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 2.62E-08 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 5.72E-11 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 2.47E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 NA 7.96E-14 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905616909 4.40E-06 9.65E-17 mr1993_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251