Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904778371:

Variant ID: vg0904778371 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 4778371
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, C: 0.30, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGGCCATGGCGCTTGGATATCTCGTGGATGGAGCGGTGCGGCAGCGAGCTGATGAGGTTCAGGTTGCCGATGATCGGCCATGGCTTTGGTCCTGGTGG[C/G]
AGCTTGTAAGCTCGGCGGCGGCGGAGCAGAACGGCCCGGAGGAGGAAGACGACGGTGGCAAGCACGACGGCAAAGAAAGTAGCCCATGATGATTGTAGTT

Reverse complement sequence

AACTACAATCATCATGGGCTACTTTCTTTGCCGTCGTGCTTGCCACCGTCGTCTTCCTCCTCCGGGCCGTTCTGCTCCGCCGCCGCCGAGCTTACAAGCT[G/C]
CCACCAGGACCAAAGCCATGGCCGATCATCGGCAACCTGAACCTCATCAGCTCGCTGCCGCACCGCTCCATCCACGAGATATCCAAGCGCCATGGCCCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.20% 21.30% 6.64% 38.83% NA
All Indica  2759 18.90% 6.40% 10.87% 63.86% NA
All Japonica  1512 62.80% 35.90% 0.20% 1.06% NA
Aus  269 20.40% 68.80% 2.23% 8.55% NA
Indica I  595 26.10% 4.00% 11.43% 58.49% NA
Indica II  465 24.10% 6.70% 12.69% 56.56% NA
Indica III  913 10.20% 4.20% 9.97% 75.68% NA
Indica Intermediate  786 20.50% 10.60% 10.43% 58.52% NA
Temperate Japonica  767 97.10% 2.10% 0.26% 0.52% NA
Tropical Japonica  504 17.30% 81.30% 0.00% 1.39% NA
Japonica Intermediate  241 49.00% 48.50% 0.41% 2.07% NA
VI/Aromatic  96 17.70% 77.10% 1.04% 4.17% NA
Intermediate  90 31.10% 31.10% 4.44% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0904778371 C -> G LOC_Os09g08990.1 synonymous_variant ; p.Leu35Leu; LOW synonymous_codon Average:80.191; most accessible tissue: Minghui63 flag leaf, score: 94.11 N N N N
vg0904778371 C -> DEL LOC_Os09g08990.1 N frameshift_variant Average:80.191; most accessible tissue: Minghui63 flag leaf, score: 94.11 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0904778371 C G 0.0 -0.01 0.0 0.0 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0904778371 NA 4.85E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0904778371 NA 2.90E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904778371 2.67E-06 2.67E-06 mr1329 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904778371 NA 2.51E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904778371 NA 1.21E-10 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904778371 NA 9.51E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904778371 NA 2.78E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904778371 NA 8.43E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904778371 NA 2.67E-07 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904778371 NA 4.95E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904778371 NA 9.93E-07 mr1341_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904778371 NA 2.99E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904778371 NA 4.56E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904778371 NA 3.54E-08 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904778371 NA 1.51E-10 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904778371 NA 7.51E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904778371 NA 2.79E-09 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904778371 NA 5.18E-10 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904778371 NA 1.58E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904778371 NA 1.61E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904778371 NA 1.37E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251