Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904628790:

Variant ID: vg0904628790 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 4628790
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

ACCTACCTACCCTGATCGCACTGGCGACCAGCGTGTCGCTGTCATTGCTCACCGTGTGGATGTTGTTCCTAGCCCACAACCTTGCCAAGTCTGTCGCTGG[C/T]
GTCGAGGCGACCATCCCGAGGTTCCTCGACCTCACGCTGATCAAGTCGTTTAAGGCCGTGGTAGACAAGCTCGGGGAGAACGGCATCATGCACTCATGGT

Reverse complement sequence

ACCATGAGTGCATGATGCCGTTCTCCCCGAGCTTGTCTACCACGGCCTTAAACGACTTGATCAGCGTGAGGTCGAGGAACCTCGGGATGGTCGCCTCGAC[G/A]
CCAGCGACAGACTTGGCAAGGTTGTGGGCTAGGAACAACATCCACACGGTGAGCAATGACAGCGACACGCTGGTCGCCAGTGCGATCAGGGTAGGTAGGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.50%	22.40%	0.06%	0.00%	NA
All Indica	2759	88.20%	11.70%	0.07%	0.00%	NA
All Japonica	1512	57.90%	42.10%	0.00%	0.00%	NA
Aus	269	69.90%	30.10%	0.00%	0.00%	NA
Indica I	595	71.30%	28.70%	0.00%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	92.00%	7.90%	0.11%	0.00%	NA
Indica Intermediate	786	90.50%	9.40%	0.13%	0.00%	NA
Temperate Japonica	767	38.90%	61.10%	0.00%	0.00%	NA
Tropical Japonica	504	83.70%	16.30%	0.00%	0.00%	NA
Japonica Intermediate	241	64.30%	35.70%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	83.30%	15.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0904628790	C -> T	LOC_Os09g08770.1	synonymous_variant ; p.Gly173Gly; LOW	synonymous_codon	Average:69.737; most accessible tissue: Zhenshan97 young leaf, score: 93.722	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0904628790	C	T	-0.05	-0.03	-0.03	-0.06	-0.06	-0.06

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0904628790	NA	2.04E-09	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904628790	NA	6.07E-10	mr1219	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904628790	NA	7.23E-10	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904628790	4.89E-06	1.40E-07	mr1047_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904628790	1.55E-06	2.67E-08	mr1189_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904628790	NA	2.77E-07	mr1201_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904628790	NA	1.53E-07	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904628790	NA	2.91E-09	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904628790	NA	2.47E-06	mr1471_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904628790	NA	6.60E-06	mr1642_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904628790	NA	1.19E-06	mr1722_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251