Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904244136:

Variant ID: vg0904244136 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 4244136
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, C: 0.07, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


CCCATCGAGTGTGGCGACGGTTCCCTGAGGTACCTGGAAATCCAGATCCTCACTATCACCGCCATCATCGGCGGGGGCCTTGTTCTTGGCCTCCTCCCGC[T/C]
GGTCACCGGCTGAGGTTGCGGGGGCTTTGCCCTCCCGTCGACCCTGCCGCTTCTCCTGATCAGCCTTTCGGAACCGCTCGGCCAAATTCTTGACCGAGCG

Reverse complement sequence

CGCTCGGTCAAGAATTTGGCCGAGCGGTTCCGAAAGGCTGATCAGGAGAAGCGGCAGGGTCGACGGGAGGGCAAAGCCCCCGCAACCTCAGCCGGTGACC[A/G]
GCGGGAGGAGGCCAAGAACAAGGCCCCCGCCGATGATGGCGGTGATAGTGAGGATCTGGATTTCCAGGTACCTCAGGGAACCGTCGCCACACTCGATGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.60% 29.40% 3.15% 22.92% NA
All Indica  2759 69.60% 3.00% 2.46% 24.86% NA
All Japonica  1512 1.10% 83.10% 0.53% 15.28% NA
Aus  269 36.40% 0.00% 23.79% 39.78% NA
Indica I  595 83.20% 5.40% 1.18% 10.25% NA
Indica II  465 80.00% 2.20% 1.51% 16.34% NA
Indica III  913 51.60% 1.80% 2.85% 43.81% NA
Indica Intermediate  786 74.20% 3.30% 3.56% 18.96% NA
Temperate Japonica  767 0.80% 79.30% 0.78% 19.17% NA
Tropical Japonica  504 1.20% 95.60% 0.00% 3.17% NA
Japonica Intermediate  241 2.10% 68.90% 0.83% 28.22% NA
VI/Aromatic  96 36.50% 11.50% 3.12% 48.96% NA
Intermediate  90 38.90% 41.10% 6.67% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0904244136 T -> DEL LOC_Os09g08180.1 N frameshift_variant Average:54.155; most accessible tissue: Zhenshan97 flag leaf, score: 87.661 N N N N
vg0904244136 T -> C LOC_Os09g08180.1 missense_variant ; p.Gln404Arg; MODERATE nonsynonymous_codon ; Q404R Average:54.155; most accessible tissue: Zhenshan97 flag leaf, score: 87.661 unknown unknown TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0904244136 T C 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0904244136 4.34E-06 NA Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0904244136 1.59E-06 NA Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0904244136 NA 1.26E-12 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904244136 NA 9.25E-22 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904244136 NA 1.00E-10 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904244136 NA 6.95E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904244136 NA 3.64E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904244136 NA 6.64E-20 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904244136 NA 7.69E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904244136 NA 2.72E-10 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904244136 NA 2.14E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904244136 3.17E-06 3.38E-25 mr1698_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904244136 NA 4.61E-06 mr1698_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904244136 NA 1.82E-18 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904244136 NA 2.10E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904244136 NA 9.09E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904244136 NA 7.52E-19 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251