Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0903361943:

Variant ID: vg0903361943 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 3361943
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGGTACTCATATACTCAGAAAGTATTTCAATACCATAAATATATTTAGAAGAGTATTCTAATAAAAGTACAAAGCTTACAAAAGAGGAAAGGAAAGCTA[C/A]
TAGAGCCATACCCGAGCTCTTCCGAAGGCTTCCGGACTCCTGATTTCTACTCTATTCCTATTCCACTAGCTAGATACTACTAAACTAAACTTGAGAGAAA

Reverse complement sequence

TTTCTCTCAAGTTTAGTTTAGTAGTATCTAGCTAGTGGAATAGGAATAGAGTAGAAATCAGGAGTCCGGAAGCCTTCGGAAGAGCTCGGGTATGGCTCTA[G/T]
TAGCTTTCCTTTCCTCTTTTGTAAGCTTTGTACTTTTATTAGAATACTCTTCTAAATATATTTATGGTATTGAAATACTTTCTGAGTATATGAGTACCTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.40%	3.00%	10.96%	19.64%	NA
All Indica	2759	48.00%	3.30%	15.95%	32.80%	NA
All Japonica	1512	99.60%	0.10%	0.00%	0.33%	NA
Aus	269	52.00%	18.60%	27.88%	1.49%	NA
Indica I	595	35.10%	3.50%	16.13%	45.21%	NA
Indica II	465	54.00%	0.40%	13.12%	32.47%	NA
Indica III	913	51.50%	5.30%	17.42%	25.85%	NA
Indica Intermediate	786	50.10%	2.40%	15.78%	31.68%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	99.60%	0.00%	0.00%	0.40%	NA
Japonica Intermediate	241	98.80%	0.40%	0.00%	0.83%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	0.00%	3.33%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0903361943	C -> DEL	N	N	silent_mutation	Average:26.579; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N
vg0903361943	C -> A	LOC_Os09g06960.1	upstream_gene_variant ; 862.0bp to feature; MODIFIER	silent_mutation	Average:26.579; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N
vg0903361943	C -> A	LOC_Os09g06950-LOC_Os09g06960	intergenic_region ; MODIFIER	silent_mutation	Average:26.579; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0903361943	2.78E-06	2.02E-07	mr1768_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251