Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0903295768:

Variant ID: vg0903295768 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 3295768
Reference Allele: T	Alternative Allele: G,C
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

GATTTTATTTTGTGAAAATTAAACTTTTTCAAGCAATACTCCTCAGTGACTATATTATTACCTACCAAGGCCATATATGATTATAAATGCAAAAACCTTG[T/G,C]
ATATGTATAGGCTGCTTGACATTACATTGAGCTTTGTAAAAATTATTGTGACCCATGTGAGATGCTTTTAATACTTTCATGATCAAGATCGCATGCACAC

Reverse complement sequence

GTGTGCATGCGATCTTGATCATGAAAGTATTAAAAGCATCTCACATGGGTCACAATAATTTTTACAAAGCTCAATGTAATGTCAAGCAGCCTATACATAT[A/C,G]
CAAGGTTTTTGCATTTATAATCATATATGGCCTTGGTAGGTAATAATATAGTCACTGAGGAGTATTGCTTGAAAAAGTTTAATTTTCACAAAATAAAATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.40%	16.10%	5.46%	37.07%	C: 1.90%
All Indica	2759	7.50%	27.30%	7.65%	55.09%	C: 2.54%
All Japonica	1512	99.20%	0.10%	0.26%	0.26%	C: 0.20%
Aus	269	2.60%	1.90%	13.75%	76.95%	C: 4.83%
Indica I	595	7.90%	9.20%	6.89%	72.27%	C: 3.70%
Indica II	465	11.00%	38.50%	7.31%	42.15%	C: 1.08%
Indica III	913	3.60%	33.40%	7.45%	52.57%	C: 2.96%
Indica Intermediate	786	9.50%	27.10%	8.65%	52.67%	C: 2.04%
Temperate Japonica	767	99.50%	0.10%	0.13%	0.13%	C: 0.13%
Tropical Japonica	504	99.00%	0.00%	0.20%	0.40%	C: 0.40%
Japonica Intermediate	241	98.80%	0.00%	0.83%	0.41%	NA
VI/Aromatic	96	94.80%	0.00%	3.12%	2.08%	NA
Intermediate	90	65.60%	5.60%	3.33%	21.11%	C: 4.44%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0903295768	T -> G	LOC_Os09g06870.1	upstream_gene_variant ; 2805.0bp to feature; MODIFIER	silent_mutation	Average:32.931; most accessible tissue: Zhenshan97 flag leaf, score: 70.837	N	N	N	N
vg0903295768	T -> G	LOC_Os09g06880.1	downstream_gene_variant ; 1969.0bp to feature; MODIFIER	silent_mutation	Average:32.931; most accessible tissue: Zhenshan97 flag leaf, score: 70.837	N	N	N	N
vg0903295768	T -> G	LOC_Os09g06870-LOC_Os09g06880	intergenic_region ; MODIFIER	silent_mutation	Average:32.931; most accessible tissue: Zhenshan97 flag leaf, score: 70.837	N	N	N	N
vg0903295768	T -> DEL	N	N	silent_mutation	Average:32.931; most accessible tissue: Zhenshan97 flag leaf, score: 70.837	N	N	N	N
vg0903295768	T -> C	LOC_Os09g06870.1	upstream_gene_variant ; 2805.0bp to feature; MODIFIER	silent_mutation	Average:32.931; most accessible tissue: Zhenshan97 flag leaf, score: 70.837	N	N	N	N
vg0903295768	T -> C	LOC_Os09g06880.1	downstream_gene_variant ; 1969.0bp to feature; MODIFIER	silent_mutation	Average:32.931; most accessible tissue: Zhenshan97 flag leaf, score: 70.837	N	N	N	N
vg0903295768	T -> C	LOC_Os09g06870-LOC_Os09g06880	intergenic_region ; MODIFIER	silent_mutation	Average:32.931; most accessible tissue: Zhenshan97 flag leaf, score: 70.837	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0903295768	NA	2.63E-08	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903295768	NA	3.07E-06	mr1053	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903295768	6.27E-07	6.72E-08	mr1128	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903295768	NA	7.60E-06	mr1139	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903295768	NA	5.47E-06	mr1147	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903295768	NA	9.40E-07	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903295768	NA	1.02E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251