Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0902575416:

Variant ID: vg0902575416 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 2575416
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


ACATAAGCCTCCACGTTTCGCCCCAACTGTTTGTACAGGACCTTGTACACCAGCCTGGCGAAGGTTGCTCCGGCATTCCTCAGGCCGAAAGGCATCCTGA[G/C]
GTGGCAAAAGGTACCAAATGGTGTGATGAAGGCTGTCTTGGGGATGTCGGCCGGGTTCATGTAGATCTGGTGATAGCCGGAATATGCATCCAGGAAGCTC

Reverse complement sequence

GAGCTTCCTGGATGCATATTCCGGCTATCACCAGATCTACATGAACCCGGCCGACATCCCCAAGACAGCCTTCATCACACCATTTGGTACCTTTTGCCAC[C/G]
TCAGGATGCCTTTCGGCCTGAGGAATGCCGGAGCAACCTTCGCCAGGCTGGTGTACAAGGTCCTGTACAAACAGTTGGGGCGAAACGTGGAGGCTTATGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.90% 6.50% 3.05% 1.54% NA
All Indica  2759 99.30% 0.40% 0.14% 0.14% NA
All Japonica  1512 70.20% 16.90% 8.60% 4.37% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 99.50% 0.00% 0.17% 0.34% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 99.00% 0.80% 0.22% 0.00% NA
Indica Intermediate  786 99.20% 0.50% 0.00% 0.25% NA
Temperate Japonica  767 97.80% 0.50% 1.04% 0.65% NA
Tropical Japonica  504 30.80% 42.10% 18.85% 8.33% NA
Japonica Intermediate  241 64.70% 16.20% 11.20% 7.88% NA
VI/Aromatic  96 59.40% 33.30% 5.21% 2.08% NA
Intermediate  90 83.30% 11.10% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0902575416 G -> DEL LOC_Os09g04830.1 N frameshift_variant Average:68.097; most accessible tissue: Zhenshan97 flag leaf, score: 86.452 N N N N
vg0902575416 G -> C LOC_Os09g04830.1 missense_variant ; p.Leu274Val; MODERATE nonsynonymous_codon ; L274V Average:68.097; most accessible tissue: Zhenshan97 flag leaf, score: 86.452 benign 0.481 TOLERATED 0.77

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0902575416 G C -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0902575416 4.41E-06 NA mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902575416 3.45E-06 NA mr1390 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251