Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0902107236:

Variant ID: vg0902107236 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 2107236
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGAGGACTGGGACCTGGGCACGAACCCTTAATCAAGCTAAGACACAAAAGGACCACGGCACAGATCATCCTCATCTCATACACACAGCAAGATGAAATT[G/A]
ACACAAAAATTTCCTCATTTTTGATTACAGATTAAGTTGATCTATACAAAAAAGAGGCCCGAAGGCCTTAGAAGAAAGAAAAGAAGAAAAAACTGAAGAA

Reverse complement sequence

TTCTTCAGTTTTTTCTTCTTTTCTTTCTTCTAAGGCCTTCGGGCCTCTTTTTTGTATAGATCAACTTAATCTGTAATCAAAAATGAGGAAATTTTTGTGT[C/T]
AATTTCATCTTGCTGTGTGTATGAGATGAGGATGATCTGTGCCGTGGTCCTTTTGTGTCTTAGCTTGATTAAGGGTTCGTGCCCAGGTCCCAGTCCTCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.00% 0.20% 5.08% 58.74% NA
All Indica  2759 26.30% 0.00% 6.27% 67.42% NA
All Japonica  1512 56.70% 0.50% 2.91% 39.81% NA
Aus  269 33.10% 0.40% 4.09% 62.45% NA
Indica I  595 18.30% 0.00% 2.02% 79.66% NA
Indica II  465 15.30% 0.00% 4.73% 80.00% NA
Indica III  913 38.40% 0.00% 11.39% 50.16% NA
Indica Intermediate  786 24.80% 0.00% 4.45% 70.74% NA
Temperate Japonica  767 85.00% 0.10% 3.26% 11.60% NA
Tropical Japonica  504 18.80% 1.00% 3.37% 76.79% NA
Japonica Intermediate  241 46.10% 0.80% 0.83% 52.28% NA
VI/Aromatic  96 9.40% 0.00% 6.25% 84.38% NA
Intermediate  90 21.10% 0.00% 6.67% 72.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0902107236 G -> DEL N N silent_mutation Average:25.032; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 N N N N
vg0902107236 G -> A LOC_Os09g04070.1 downstream_gene_variant ; 508.0bp to feature; MODIFIER silent_mutation Average:25.032; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 N N N N
vg0902107236 G -> A LOC_Os09g04080.1 downstream_gene_variant ; 119.0bp to feature; MODIFIER silent_mutation Average:25.032; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 N N N N
vg0902107236 G -> A LOC_Os09g04070-LOC_Os09g04080 intergenic_region ; MODIFIER silent_mutation Average:25.032; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0902107236 NA 5.75E-14 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0902107236 NA 1.64E-14 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 3.68E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 2.55E-08 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 1.62E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 1.52E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 1.30E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 6.16E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 2.62E-12 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 6.21E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 2.55E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 3.50E-07 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 8.44E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 9.32E-07 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 8.26E-07 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 3.36E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 9.96E-06 mr1374_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 6.23E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 1.11E-06 2.05E-10 mr1418_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 3.19E-06 5.45E-09 mr1419_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 3.50E-06 2.61E-09 mr1420_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 2.74E-07 1.42E-09 mr1467_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 4.90E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 1.12E-06 1.96E-10 mr1488_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 7.58E-08 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 1.03E-08 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 2.17E-07 1.08E-12 mr1506_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 4.93E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 7.20E-11 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 1.17E-06 1.91E-09 mr1556_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 1.75E-09 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 2.12E-13 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 1.16E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 7.70E-06 8.51E-07 mr1665_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 6.31E-06 6.30E-06 mr1674_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 2.47E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 1.69E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 6.72E-06 NA mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 1.54E-06 6.61E-09 mr1764_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 2.98E-08 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 2.80E-06 2.79E-07 mr1811_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 3.49E-07 1.62E-09 mr1812_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 1.05E-06 mr1816_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 6.58E-06 NA mr1823_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 1.37E-06 mr1832_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 1.23E-06 mr1833_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 5.06E-06 mr1843_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 3.14E-15 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 1.67E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 4.60E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 4.92E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 6.13E-06 mr1984_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0902107236 NA 3.43E-07 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251