Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901629789:

Variant ID: vg0901629789 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 1629789
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGAGGAAGGAGATGACGGGTAGGCCCCACCCGTCAGCGAGGGTGGCGGGCGGGCCCGCCCGTCAGCGGCGCGCGCGCGGGGAGGGGCCGAGTGGGCCGC[G/T]
GGGGAAGAGGAGAGAGGGGGAGGGAAGTGGGCCGAGCCGGCCCAAGAGAGGGAGGGAGGGTTTTTCTTTTTATAAAACCTTTTTCAACTTTGTTTATTTC

Reverse complement sequence

GAAATAAACAAAGTTGAAAAAGGTTTTATAAAAAGAAAAACCCTCCCTCCCTCTCTTGGGCCGGCTCGGCCCACTTCCCTCCCCCTCTCTCCTCTTCCCC[C/A]
GCGGCCCACTCGGCCCCTCCCCGCGCGCGCGCCGCTGACGGGCGGGCCCGCCCGCCACCCTCGCTGACGGGTGGGGCCTACCCGTCATCTCCTTCCTCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.60% 3.70% 14.58% 18.07% NA
All Indica  2759 67.30% 0.40% 18.59% 13.63% NA
All Japonica  1512 56.80% 9.70% 7.28% 26.19% NA
Aus  269 88.80% 0.00% 5.20% 5.95% NA
Indica I  595 49.90% 0.00% 40.34% 9.75% NA
Indica II  465 65.80% 0.00% 18.28% 15.91% NA
Indica III  913 80.30% 0.50% 5.37% 13.80% NA
Indica Intermediate  786 66.40% 0.90% 17.68% 15.01% NA
Temperate Japonica  767 81.00% 0.30% 11.73% 7.04% NA
Tropical Japonica  504 24.60% 23.00% 2.18% 50.20% NA
Japonica Intermediate  241 47.30% 12.00% 3.73% 36.93% NA
VI/Aromatic  96 7.30% 11.50% 34.38% 46.88% NA
Intermediate  90 48.90% 6.70% 21.11% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0901629789 G -> DEL N N silent_mutation Average:61.314; most accessible tissue: Zhenshan97 flag leaf, score: 86.78 N N N N
vg0901629789 G -> T LOC_Os09g03360.1 upstream_gene_variant ; 1080.0bp to feature; MODIFIER silent_mutation Average:61.314; most accessible tissue: Zhenshan97 flag leaf, score: 86.78 N N N N
vg0901629789 G -> T LOC_Os09g03350.1 downstream_gene_variant ; 3652.0bp to feature; MODIFIER silent_mutation Average:61.314; most accessible tissue: Zhenshan97 flag leaf, score: 86.78 N N N N
vg0901629789 G -> T LOC_Os09g03350-LOC_Os09g03360 intergenic_region ; MODIFIER silent_mutation Average:61.314; most accessible tissue: Zhenshan97 flag leaf, score: 86.78 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0901629789 G T 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0901629789 NA 6.68E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901629789 NA 8.72E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901629789 NA 1.39E-07 mr1425_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901629789 4.63E-06 2.02E-08 mr1425_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901629789 NA 7.49E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251