Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901498790:

Variant ID: vg0901498790 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 1498790
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

AAAATATAGGGGTCTGACACTGCCTGCCATCTTTTAAACCCAGACTAAAAATGATATTTAGTCCCAGTTGATGTTACCAACCGGGACTAAAGATCAAAAA[A/G]
TACTTCTGAGCGGTTTTTAATACAACCGGGACTATTGTGAAATTTGGCTGACCGACCAAAGATGGTTTCTCCAGTAGTGTAGAGCGGTTGGACCGGAGCT

Reverse complement sequence

AGCTCCGGTCCAACCGCTCTACACTACTGGAGAAACCATCTTTGGTCGGTCAGCCAAATTTCACAATAGTCCCGGTTGTATTAAAAACCGCTCAGAAGTA[T/C]
TTTTTGATCTTTAGTCCCGGTTGGTAACATCAACTGGGACTAAATATCATTTTTAGTCTGGGTTTAAAAGATGGCAGGCAGTGTCAGACCCCTATATTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.20%	22.80%	0.00%	0.00%	NA
All Indica	2759	96.90%	3.10%	0.00%	0.00%	NA
All Japonica	1512	35.70%	64.30%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	95.60%	4.40%	0.00%	0.00%	NA
Indica II	465	92.30%	7.70%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	97.20%	2.80%	0.00%	0.00%	NA
Temperate Japonica	767	3.10%	96.90%	0.00%	0.00%	NA
Tropical Japonica	504	78.40%	21.60%	0.00%	0.00%	NA
Japonica Intermediate	241	50.20%	49.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	80.00%	20.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0901498790	A -> G	LOC_Os09g03130.1	downstream_gene_variant ; 2412.0bp to feature; MODIFIER	silent_mutation	Average:66.955; most accessible tissue: Zhenshan97 young leaf, score: 80.056	N	N	N	N
vg0901498790	A -> G	LOC_Os09g03140.1	downstream_gene_variant ; 4988.0bp to feature; MODIFIER	silent_mutation	Average:66.955; most accessible tissue: Zhenshan97 young leaf, score: 80.056	N	N	N	N
vg0901498790	A -> G	LOC_Os09g03130-LOC_Os09g03140	intergenic_region ; MODIFIER	silent_mutation	Average:66.955; most accessible tissue: Zhenshan97 young leaf, score: 80.056	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0901498790	NA	1.62E-13	Grain_thickness	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901498790	4.40E-06	NA	mr1101	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901498790	NA	8.30E-06	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901498790	NA	1.66E-09	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901498790	NA	2.47E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901498790	NA	2.33E-07	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901498790	8.18E-07	NA	mr1098_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901498790	2.27E-07	NA	mr1150_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901498790	NA	6.03E-10	mr1552_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901498790	NA	7.13E-08	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901498790	NA	6.83E-08	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251