Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900852915:

Variant ID: vg0900852915 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 852915
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, A: 0.04, T: 0.00, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

CTGTGTCGGGACAGGCTTCCGTCACAAATCAAAACTCACAGATGTGAGAAGTCATTTCTATCGGGCATTTGGCCGTCACGGACAGTTATCTTAATCAGGT[C/A]
AAAAATGGAGCCTGTCACCAATAGATTTGATCCAACAGATGAGTCAAAATTATTACCCAAAATTATTCACATTTCTGGGTACGAAGCAATTGACTGTAGG

Reverse complement sequence

CCTACAGTCAATTGCTTCGTACCCAGAAATGTGAATAATTTTGGGTAATAATTTTGACTCATCTGTTGGATCAAATCTATTGGTGACAGGCTCCATTTTT[G/T]
ACCTGATTAAGATAACTGTCCGTGACGGCCAAATGCCCGATAGAAATGACTTCTCACATCTGTGAGTTTTGATTTGTGACGGAAGCCTGTCCCGACACAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.80%	11.20%	0.04%	0.00%	NA
All Indica	2759	97.80%	2.20%	0.00%	0.00%	NA
All Japonica	1512	71.20%	28.60%	0.13%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.00%	1.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	96.90%	3.10%	0.00%	0.00%	NA
Indica Intermediate	786	96.60%	3.40%	0.00%	0.00%	NA
Temperate Japonica	767	97.10%	2.70%	0.13%	0.00%	NA
Tropical Japonica	504	41.30%	58.50%	0.20%	0.00%	NA
Japonica Intermediate	241	51.50%	48.50%	0.00%	0.00%	NA
VI/Aromatic	96	84.40%	15.60%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0900852915	C -> A	LOC_Os09g02160.1	downstream_gene_variant ; 2784.0bp to feature; MODIFIER	silent_mutation	Average:74.307; most accessible tissue: Minghui63 panicle, score: 85.556	N	N	N	N
vg0900852915	C -> A	LOC_Os09g02170.1	downstream_gene_variant ; 1804.0bp to feature; MODIFIER	silent_mutation	Average:74.307; most accessible tissue: Minghui63 panicle, score: 85.556	N	N	N	N
vg0900852915	C -> A	LOC_Os09g02160-LOC_Os09g02170	intergenic_region ; MODIFIER	silent_mutation	Average:74.307; most accessible tissue: Minghui63 panicle, score: 85.556	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0900852915	NA	6.80E-07	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852915	NA	1.29E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852915	3.33E-06	3.32E-06	mr1873	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852915	NA	4.03E-07	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852915	8.27E-06	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852915	NA	7.77E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852915	NA	4.27E-06	mr1425_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852915	NA	6.34E-06	mr1425_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852915	NA	6.59E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852915	NA	3.42E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852915	NA	5.60E-13	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251