Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900852151:

Variant ID: vg0900852151 (JBrowse)	Variation Type: INDEL
Chromosome: chr09	Position: 852151
Reference Allele: A	Alternative Allele: AT,T,ATT
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAGAGGTCCGCTTGTAAACGTAGAAAGCATATCTTTTAAATGGCCGCTAGAGAAGATCCATTTTTACTGGTGGTTCGTGATTGGAAACCCTCTAATAAT[A/AT,T,ATT]
TTTTTTTTACAAGCGTGTCTTTGTCTATTAGTAAAAATAAAAGTGATATGTAACGAAAAATGGTTTTTATAGTGACAAATCGATCGCTTCCAAAATATCG

Reverse complement sequence

CGATATTTTGGAAGCGATCGATTTGTCACTATAAAAACCATTTTTCGTTACATATCACTTTTATTTTTACTAATAGACAAAGACACGCTTGTAAAAAAAA[T/AT,A,AAT]
ATTATTAGAGGGTTTCCAATCACGAACCACCAGTAAAAATGGATCTTCTCTAGCGGCCATTTAAAAGATATGCTTTCTACGTTTACAAGCGGACCTCTTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.40%	34.90%	0.17%	0.00%	AT: 4.70%; ATT: 0.83%
All Indica	2759	48.20%	50.10%	0.22%	0.00%	ATT: 1.30%; AT: 0.18%
All Japonica	1512	77.10%	14.20%	0.00%	0.00%	AT: 8.73%; ATT: 0.07%
Aus	269	97.40%	1.90%	0.00%	0.00%	AT: 0.37%; ATT: 0.37%
Indica I	595	39.70%	59.80%	0.34%	0.00%	AT: 0.17%
Indica II	465	29.20%	63.90%	0.43%	0.00%	ATT: 6.45%
Indica III	913	59.80%	40.10%	0.00%	0.00%	AT: 0.11%
Indica Intermediate	786	52.50%	46.10%	0.25%	0.00%	ATT: 0.76%; AT: 0.38%
Temperate Japonica	767	80.70%	2.60%	0.00%	0.00%	AT: 16.69%
Tropical Japonica	504	82.10%	17.50%	0.00%	0.00%	AT: 0.40%
Japonica Intermediate	241	54.80%	44.00%	0.00%	0.00%	AT: 0.83%; ATT: 0.41%
VI/Aromatic	96	5.20%	17.70%	1.04%	0.00%	AT: 75.00%; ATT: 1.04%
Intermediate	90	50.00%	35.60%	1.11%	0.00%	AT: 13.33%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0900852151	A -> T	LOC_Os09g02160.1	downstream_gene_variant ; 2020.0bp to feature; MODIFIER	silent_mutation	Average:58.483; most accessible tissue: Minghui63 root, score: 69.846	N	N	N	N
vg0900852151	A -> T	LOC_Os09g02170.1	downstream_gene_variant ; 2568.0bp to feature; MODIFIER	silent_mutation	Average:58.483; most accessible tissue: Minghui63 root, score: 69.846	N	N	N	N
vg0900852151	A -> T	LOC_Os09g02160-LOC_Os09g02170	intergenic_region ; MODIFIER	silent_mutation	Average:58.483; most accessible tissue: Minghui63 root, score: 69.846	N	N	N	N
vg0900852151	A -> ATT	LOC_Os09g02160.1	downstream_gene_variant ; 2021.0bp to feature; MODIFIER	silent_mutation	Average:58.483; most accessible tissue: Minghui63 root, score: 69.846	N	N	N	N
vg0900852151	A -> ATT	LOC_Os09g02170.1	downstream_gene_variant ; 2567.0bp to feature; MODIFIER	silent_mutation	Average:58.483; most accessible tissue: Minghui63 root, score: 69.846	N	N	N	N
vg0900852151	A -> ATT	LOC_Os09g02160-LOC_Os09g02170	intergenic_region ; MODIFIER	silent_mutation	Average:58.483; most accessible tissue: Minghui63 root, score: 69.846	N	N	N	N
vg0900852151	A -> AT	LOC_Os09g02160.1	downstream_gene_variant ; 2021.0bp to feature; MODIFIER	silent_mutation	Average:58.483; most accessible tissue: Minghui63 root, score: 69.846	N	N	N	N
vg0900852151	A -> AT	LOC_Os09g02170.1	downstream_gene_variant ; 2567.0bp to feature; MODIFIER	silent_mutation	Average:58.483; most accessible tissue: Minghui63 root, score: 69.846	N	N	N	N
vg0900852151	A -> AT	LOC_Os09g02160-LOC_Os09g02170	intergenic_region ; MODIFIER	silent_mutation	Average:58.483; most accessible tissue: Minghui63 root, score: 69.846	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0900852151	NA	9.99E-08	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852151	NA	3.13E-19	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852151	NA	4.84E-06	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852151	NA	6.42E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852151	NA	8.63E-09	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852151	NA	1.09E-06	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852151	7.46E-06	7.46E-06	mr1192_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852151	NA	7.78E-06	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852151	NA	2.23E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852151	NA	2.17E-14	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852151	NA	3.92E-08	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852151	NA	3.16E-06	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852151	NA	8.13E-09	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852151	2.17E-06	NA	mr1691_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852151	NA	3.02E-06	mr1691_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852151	NA	2.48E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852151	NA	1.18E-10	mr1756_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852151	NA	9.22E-06	mr1851_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900852151	NA	8.41E-13	mr1904_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251