Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900730086:

Variant ID: vg0900730086 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 730086
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

ACCATGGAAAAGCTCCAAAATAATCTCTTACTGCATAGTTGACGATGCAGTTAGATTTTAAAGCATGTTATGATTAATCATAGTTCCTAGAACTAAGAGT[G/A]
GTAAATAGCGCTCATAAAACACTCAAAAGGTGTAAACCACTCAATTATACTGTGTTATAAGTTGTGCACTAATTGAACACAGTTTTCTATTCTGGTAGCA

Reverse complement sequence

TGCTACCAGAATAGAAAACTGTGTTCAATTAGTGCACAACTTATAACACAGTATAATTGAGTGGTTTACACCTTTTGAGTGTTTTATGAGCGCTATTTAC[C/T]
ACTCTTAGTTCTAGGAACTATGATTAATCATAACATGCTTTAAAATCTAACTGCATCGTCAACTATGCAGTAAGAGATTATTTTGGAGCTTTTCCATGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.50%	10.90%	4.13%	30.49%	NA
All Indica	2759	24.60%	17.40%	6.96%	51.07%	NA
All Japonica	1512	99.30%	0.10%	0.00%	0.60%	NA
Aus	269	89.20%	10.80%	0.00%	0.00%	NA
Indica I	595	8.70%	32.30%	4.03%	54.96%	NA
Indica II	465	22.60%	9.50%	6.24%	61.72%	NA
Indica III	913	32.70%	9.30%	9.97%	47.97%	NA
Indica Intermediate	786	28.20%	20.20%	6.11%	45.42%	NA
Temperate Japonica	767	99.30%	0.10%	0.00%	0.52%	NA
Tropical Japonica	504	99.40%	0.00%	0.00%	0.60%	NA
Japonica Intermediate	241	99.20%	0.00%	0.00%	0.83%	NA
VI/Aromatic	96	96.90%	1.00%	0.00%	2.08%	NA
Intermediate	90	68.90%	4.40%	3.33%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0900730086	G -> DEL	N	N	silent_mutation	Average:18.099; most accessible tissue: Zhenshan97 flag leaf, score: 35.167	N	N	N	N
vg0900730086	G -> A	LOC_Os09g02030.1	downstream_gene_variant ; 1897.0bp to feature; MODIFIER	silent_mutation	Average:18.099; most accessible tissue: Zhenshan97 flag leaf, score: 35.167	N	N	N	N
vg0900730086	G -> A	LOC_Os09g02020-LOC_Os09g02030	intergenic_region ; MODIFIER	silent_mutation	Average:18.099; most accessible tissue: Zhenshan97 flag leaf, score: 35.167	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0900730086	NA	6.77E-06	mr1085	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900730086	NA	4.01E-06	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900730086	NA	9.65E-06	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900730086	NA	9.27E-06	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900730086	NA	2.75E-06	mr1224	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900730086	NA	2.02E-06	mr1225	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900730086	1.32E-06	1.10E-06	mr1620	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251