RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0900715492:

Variant ID: vg0900715492 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 715492
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAAGGGGGTTCCCAACCGGGAGTAAAAAGGGTTTCTCTACCAGTGAGTAACACAACACATGCATGGTAACAGCCATGAGTCTGAAACACGCGCTGCTAC[G/A]
AGAAAGTTTTTTCGTACGGTCAAATCCGATTTTTACATCTTACGGTAAAATCCGATTTTTACATCTTGGTGGACGGTCCGCACGCACCCAGGAGTCTGCA

Reverse complement sequence

TGCAGACTCCTGGGTGCGTGCGGACCGTCCACCAAGATGTAAAAATCGGATTTTACCGTAAGATGTAAAAATCGGATTTGACCGTACGAAAAAACTTTCT[C/T]
GTAGCAGCGCGTGTTTCAGACTCATGGCTGTTACCATGCATGTGTTGTGTTACTCACTGGTAGAGAAACCCTTTTTACTCCCGGTTGGGAACCCCCTTTA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.40%	2.60%	0.00%	0.00%	NA
All Indica	2759	99.80%	0.20%	0.00%	0.00%	NA
All Japonica	1512	92.60%	7.40%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	98.20%	1.80%	0.00%	0.00%	NA
Tropical Japonica	504	92.50%	7.50%	0.00%	0.00%	NA
Japonica Intermediate	241	75.10%	24.90%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0900715492	G -> A	LOC_Os09g02020.1	upstream_gene_variant ; 4548.0bp to feature; MODIFIER	silent_mutation	Average:56.722; most accessible tissue: Minghui63 flag leaf, score: 70.17	N	N	N	N
vg0900715492	G -> A	LOC_Os09g02020-LOC_Os09g02030	intergenic_region ; MODIFIER	silent_mutation	Average:56.722; most accessible tissue: Minghui63 flag leaf, score: 70.17	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0900715492	3.01E-06	3.01E-06	mr1065	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900715492	4.62E-06	4.62E-06	mr1068	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900715492	NA	7.44E-06	mr1096	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900715492	7.43E-06	1.78E-06	mr1211	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900715492	1.36E-06	1.36E-06	mr1526	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 5 of 5 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0900715492:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact