Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900371978:

Variant ID: vg0900371978 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 371978
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACCAAACGGAAAGCATAGGAAGATGGAACTCCATAACTTGATAGGCACTTTTGTACTCAGATTATGTCGCAAGCAATCAAGATGAATATTATGAAAATT[A/G]
TTAAAAAAATATGATATAACATCTATAGCCCCCGACTCACTAGTCAACGGCGAACCAGTTGATGTAGTGAGGCAGAGGAAAAGGAAAATATCATATAAGG

Reverse complement sequence

CCTTATATGATATTTTCCTTTTCCTCTGCCTCACTACATCAACTGGTTCGCCGTTGACTAGTGAGTCGGGGGCTATAGATGTTATATCATATTTTTTTAA[T/C]
AATTTTCATAATATTCATCTTGATTGCTTGCGACATAATCTGAGTACAAAAGTGCCTATCAAGTTATGGAGTTCCATCTTCCTATGCTTTCCGTTTGGTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.70%	1.70%	19.21%	46.40%	NA
All Indica	2759	5.30%	2.80%	26.42%	65.49%	NA
All Japonica	1512	82.20%	0.20%	0.20%	17.39%	NA
Aus	269	4.10%	0.00%	62.45%	33.46%	NA
Indica I	595	8.10%	0.70%	11.76%	79.50%	NA
Indica II	465	3.90%	1.10%	23.87%	71.18%	NA
Indica III	913	3.10%	5.40%	40.42%	51.15%	NA
Indica Intermediate	786	6.70%	2.30%	22.77%	68.19%	NA
Temperate Japonica	767	67.40%	0.30%	0.26%	32.07%	NA
Tropical Japonica	504	99.40%	0.00%	0.00%	0.60%	NA
Japonica Intermediate	241	93.40%	0.40%	0.41%	5.81%	NA
VI/Aromatic	96	92.70%	0.00%	4.17%	3.12%	NA
Intermediate	90	62.20%	0.00%	4.44%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0900371978	A -> G	LOC_Os09g01520.1	upstream_gene_variant ; 1373.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0900371978	A -> G	LOC_Os09g01500.1	downstream_gene_variant ; 2487.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0900371978	A -> G	LOC_Os09g01510.1	downstream_gene_variant ; 608.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0900371978	A -> G	LOC_Os09g01510-LOC_Os09g01520	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0900371978	A -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0900371978	NA	4.27E-11	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900371978	NA	1.40E-15	mr1324	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900371978	NA	4.69E-13	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900371978	NA	2.12E-15	mr1326	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900371978	NA	9.15E-06	mr1326	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900371978	NA	2.18E-13	mr1335	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900371978	NA	1.08E-06	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900371978	NA	2.12E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900371978	NA	1.73E-11	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900371978	NA	5.12E-11	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900371978	NA	2.46E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251