Search for Variation information by Variation ID:
Detailed information for vg0900280526:
| Variant ID: vg0900280526 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 280526 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 113. )
Flanking Sequence (100 bp) in Reference Genome:
AGCTTCGGTTTCAGCTTCAGCCGACTGGTGTCCAGTCGGGGGTTGATCACCCGAGTCTACATTGTCGGTTGTCGGCTGGTTATCACTCGGATGGCCTTCG[A/G]
CAGTCGGCCCGGTTTCTTTGGAAGAACTCGTCTCCATGTTAGCCGGATTAGAGTCCTTTCTAGATGGATCTAGGTCGGATGGTTTCCTACAAGTTTTTGT
Reverse complement sequence
ACAAAAACTTGTAGGAAACCATCCGACCTAGATCCATCTAGAAAGGACTCTAATCCGGCTAACATGGAGACGAGTTCTTCCAAAGAAACCGGGCCGACTG[T/C]
CGAAGGCCATCCGAGTGATAACCAGCCGACAACCGACAATGTAGACTCGGGTGATCAACCCCCGACTGGACACCAGTCGGCTGAAGCTGAAACCGAAGCT
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.20% | 33.90% | 1.44% | 13.50% | NA |
| All Indica | 2759 | 80.50% | 6.70% | 2.10% | 10.73% | NA |
| All Japonica | 1512 | 0.60% | 83.20% | 0.40% | 15.81% | NA |
| Aus | 269 | 62.10% | 3.70% | 0.74% | 33.46% | NA |
| Indica I | 595 | 68.60% | 12.60% | 0.84% | 17.98% | NA |
| Indica II | 465 | 86.00% | 6.00% | 2.15% | 5.81% | NA |
| Indica III | 913 | 90.70% | 2.30% | 2.74% | 4.27% | NA |
| Indica Intermediate | 786 | 74.40% | 7.60% | 2.29% | 15.65% | NA |
| Temperate Japonica | 767 | 0.90% | 69.20% | 0.65% | 29.20% | NA |
| Tropical Japonica | 504 | 0.00% | 99.40% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 0.80% | 93.80% | 0.41% | 4.98% | NA |
| VI/Aromatic | 96 | 0.00% | 95.80% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 23.30% | 64.40% | 2.22% | 10.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0900280526 | A -> G | LOC_Os09g01350.1 | missense_variant ; p.Val411Ala; MODERATE | nonsynonymous_codon ; V411A | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | benign  |
-0.399 |
TOLERATED | 1.00 |
| vg0900280526 | A -> DEL | LOC_Os09g01350.1 | N | frameshift_variant | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0900280526 | 1.78E-07 | 1.27E-08 | mr1008 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900280526 | 4.78E-07 | 2.32E-08 | mr1009 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900280526 | NA | 1.33E-11 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900280526 | NA | 8.46E-07 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900280526 | NA | 2.44E-07 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900280526 | NA | 2.31E-16 | mr1836_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900280526 | 8.54E-07 | NA | mr1954_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |