Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0827935818:

Variant ID: vg0827935818 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 27935818
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

AAGTGAAGGAATACATAGAAATAAAAAAAAAAGAAGAAGGGAGTCACCACAACCTTCCCAAAGGACAAAGAGACATAGTAAAAGCAAAGTGAGCATAACT[C/T]
AACTGGTTAGGTTTCTTGCTACAGAACCTGTTCATCTAGGTTAAGTCCTAAACTTGACATGAGTGCTCGCATTTTAGTGTTATGCGATGTACCCATCAAC

Reverse complement sequence

GTTGATGGGTACATCGCATAACACTAAAATGCGAGCACTCATGTCAAGTTTAGGACTTAACCTAGATGAACAGGTTCTGTAGCAAGAAACCTAACCAGTT[G/A]
AGTTATGCTCACTTTGCTTTTACTATGTCTCTTTGTCCTTTGGGAAGGTTGTGGTGACTCCCTTCTTCTTTTTTTTTTATTTCTATGTATTCCTTCACTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.00%	8.00%	0.00%	0.00%	NA
All Indica	2759	91.80%	8.20%	0.00%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	49.80%	50.20%	0.00%	0.00%	NA
Indica I	595	98.30%	1.70%	0.00%	0.00%	NA
Indica II	465	95.90%	4.10%	0.00%	0.00%	NA
Indica III	913	89.90%	10.10%	0.00%	0.00%	NA
Indica Intermediate	786	86.50%	13.50%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0827935818	C -> T	LOC_Os08g44390.1	upstream_gene_variant ; 1442.0bp to feature; MODIFIER	silent_mutation	Average:71.013; most accessible tissue: Callus, score: 93.421	N	N	N	N
vg0827935818	C -> T	LOC_Os08g44400.1	upstream_gene_variant ; 2393.0bp to feature; MODIFIER	silent_mutation	Average:71.013; most accessible tissue: Callus, score: 93.421	N	N	N	N
vg0827935818	C -> T	LOC_Os08g44390.2	upstream_gene_variant ; 1442.0bp to feature; MODIFIER	silent_mutation	Average:71.013; most accessible tissue: Callus, score: 93.421	N	N	N	N
vg0827935818	C -> T	LOC_Os08g44390.4	upstream_gene_variant ; 1442.0bp to feature; MODIFIER	silent_mutation	Average:71.013; most accessible tissue: Callus, score: 93.421	N	N	N	N
vg0827935818	C -> T	LOC_Os08g44390.3	upstream_gene_variant ; 1442.0bp to feature; MODIFIER	silent_mutation	Average:71.013; most accessible tissue: Callus, score: 93.421	N	N	N	N
vg0827935818	C -> T	LOC_Os08g44400.2	upstream_gene_variant ; 2393.0bp to feature; MODIFIER	silent_mutation	Average:71.013; most accessible tissue: Callus, score: 93.421	N	N	N	N
vg0827935818	C -> T	LOC_Os08g44400.3	upstream_gene_variant ; 2393.0bp to feature; MODIFIER	silent_mutation	Average:71.013; most accessible tissue: Callus, score: 93.421	N	N	N	N
vg0827935818	C -> T	LOC_Os08g44380.1	downstream_gene_variant ; 3141.0bp to feature; MODIFIER	silent_mutation	Average:71.013; most accessible tissue: Callus, score: 93.421	N	N	N	N
vg0827935818	C -> T	LOC_Os08g44380.2	downstream_gene_variant ; 3141.0bp to feature; MODIFIER	silent_mutation	Average:71.013; most accessible tissue: Callus, score: 93.421	N	N	N	N
vg0827935818	C -> T	LOC_Os08g44390-LOC_Os08g44400	intergenic_region ; MODIFIER	silent_mutation	Average:71.013; most accessible tissue: Callus, score: 93.421	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0827935818	NA	1.42E-07	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827935818	NA	6.60E-09	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827935818	NA	1.88E-06	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827935818	3.95E-06	3.95E-06	mr1674	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827935818	NA	6.80E-07	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827935818	NA	8.05E-08	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827935818	NA	4.48E-06	mr1980_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251