Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0827581531:

Variant ID: vg0827581531 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 27581531
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAGGTAAATTTTGGTAGTACCAAATACTTTGACAACTTATGTGTCTTATTGGTATATTTTGGTAGCAAATTAAACACTAGCCAAACTACTATTCAAAAT[G/A]
CCAATAATTTGGTAGGGCACGTTTTGGCATCAAACCAAAATGGCCTTCAGTGGCTTAAATCATACTAGTAGTACTCATGTGTGCGAAACAGTCCCTACCC

Reverse complement sequence

GGGTAGGGACTGTTTCGCACACATGAGTACTACTAGTATGATTTAAGCCACTGAAGGCCATTTTGGTTTGATGCCAAAACGTGCCCTACCAAATTATTGG[C/T]
ATTTTGAATAGTAGTTTGGCTAGTGTTTAATTTGCTACCAAAATATACCAATAAGACACATAAGTTGTCAAAGTATTTGGTACTACCAAAATTTACCTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.00% 28.00% 0.99% 0.00% NA
All Indica  2759 95.70% 4.20% 0.11% 0.00% NA
All Japonica  1512 28.20% 69.40% 2.38% 0.00% NA
Aus  269 79.60% 20.10% 0.37% 0.00% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 89.00% 10.30% 0.65% 0.00% NA
Indica III  913 97.30% 2.70% 0.00% 0.00% NA
Indica Intermediate  786 95.30% 4.70% 0.00% 0.00% NA
Temperate Japonica  767 5.60% 92.20% 2.22% 0.00% NA
Tropical Japonica  504 67.50% 29.60% 2.98% 0.00% NA
Japonica Intermediate  241 17.80% 80.50% 1.66% 0.00% NA
VI/Aromatic  96 11.50% 87.50% 1.04% 0.00% NA
Intermediate  90 70.00% 23.30% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0827581531 G -> A LOC_Os08g43620.1 upstream_gene_variant ; 1466.0bp to feature; MODIFIER silent_mutation Average:59.306; most accessible tissue: Callus, score: 97.02 N N N N
vg0827581531 G -> A LOC_Os08g43630.1 upstream_gene_variant ; 4568.0bp to feature; MODIFIER silent_mutation Average:59.306; most accessible tissue: Callus, score: 97.02 N N N N
vg0827581531 G -> A LOC_Os08g43600.1 downstream_gene_variant ; 4477.0bp to feature; MODIFIER silent_mutation Average:59.306; most accessible tissue: Callus, score: 97.02 N N N N
vg0827581531 G -> A LOC_Os08g43600-LOC_Os08g43620 intergenic_region ; MODIFIER silent_mutation Average:59.306; most accessible tissue: Callus, score: 97.02 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0827581531 G A 0.07 0.06 0.04 0.0 0.04 0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0827581531 NA 5.83E-12 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0827581531 NA 8.15E-08 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 NA 3.38E-06 mr1398 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 NA 3.85E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 4.58E-06 1.06E-06 mr1600 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 NA 9.00E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 NA 3.10E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 NA 4.46E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 NA 6.71E-17 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 NA 8.18E-08 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 NA 3.61E-10 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 NA 2.28E-11 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 NA 2.09E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 NA 6.32E-10 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 NA 2.90E-08 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 NA 4.95E-09 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 NA 1.45E-09 mr1251_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 NA 3.53E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 NA 4.95E-07 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 NA 1.58E-09 mr1435_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 NA 2.95E-08 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 NA 5.16E-41 mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 NA 3.08E-12 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 NA 5.78E-12 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 NA 1.32E-09 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827581531 NA 1.71E-09 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251