Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0827402797:

Variant ID: vg0827402797 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 27402797
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACATTCGATCAATCACATTGATTCAGTATCGCGCAAAAATGAGACAACAGTGATCGATATCACCTATAATAAAGCCTTGTTTAGTTGATGAAAATTTTT[G/A,C]
GGTTTGGTTGTCAAATTAGATATACGGACACACAAGTACATATTTAAAAGTTTTATTCACAAATTAATTTTTATTTGTAATTATGTTGAAATGATGGGGC

Reverse complement sequence

GCCCCATCATTTCAACATAATTACAAATAAAAATTAATTTGTGAATAAAACTTTTAAATATGTACTTGTGTGTCCGTATATCTAATTTGACAACCAAACC[C/T,G]
AAAAATTTTCATCAACTAAACAAGGCTTTATTATAGGTGATATCGATCACTGTTGTCTCATTTTTGCGCGATACTGAATCAATGTGATTGATCGAATGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.70% 5.20% 0.02% 0.00% C: 0.08%
All Indica  2759 97.60% 2.20% 0.04% 0.00% C: 0.14%
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 36.10% 63.90% 0.00% 0.00% NA
Indica I  595 99.30% 0.00% 0.17% 0.00% C: 0.50%
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 98.10% 1.90% 0.00% 0.00% NA
Indica Intermediate  786 96.20% 3.70% 0.00% 0.00% C: 0.13%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0827402797 G -> C LOC_Os08g43370.1 upstream_gene_variant ; 642.0bp to feature; MODIFIER silent_mutation Average:84.414; most accessible tissue: Zhenshan97 panicle, score: 92.533 N N N N
vg0827402797 G -> C LOC_Os08g43360.1 downstream_gene_variant ; 576.0bp to feature; MODIFIER silent_mutation Average:84.414; most accessible tissue: Zhenshan97 panicle, score: 92.533 N N N N
vg0827402797 G -> C LOC_Os08g43360.2 downstream_gene_variant ; 576.0bp to feature; MODIFIER silent_mutation Average:84.414; most accessible tissue: Zhenshan97 panicle, score: 92.533 N N N N
vg0827402797 G -> C LOC_Os08g43360.3 downstream_gene_variant ; 576.0bp to feature; MODIFIER silent_mutation Average:84.414; most accessible tissue: Zhenshan97 panicle, score: 92.533 N N N N
vg0827402797 G -> C LOC_Os08g43360-LOC_Os08g43370 intergenic_region ; MODIFIER silent_mutation Average:84.414; most accessible tissue: Zhenshan97 panicle, score: 92.533 N N N N
vg0827402797 G -> A LOC_Os08g43370.1 upstream_gene_variant ; 642.0bp to feature; MODIFIER silent_mutation Average:84.414; most accessible tissue: Zhenshan97 panicle, score: 92.533 N N N N
vg0827402797 G -> A LOC_Os08g43360.1 downstream_gene_variant ; 576.0bp to feature; MODIFIER silent_mutation Average:84.414; most accessible tissue: Zhenshan97 panicle, score: 92.533 N N N N
vg0827402797 G -> A LOC_Os08g43360.2 downstream_gene_variant ; 576.0bp to feature; MODIFIER silent_mutation Average:84.414; most accessible tissue: Zhenshan97 panicle, score: 92.533 N N N N
vg0827402797 G -> A LOC_Os08g43360.3 downstream_gene_variant ; 576.0bp to feature; MODIFIER silent_mutation Average:84.414; most accessible tissue: Zhenshan97 panicle, score: 92.533 N N N N
vg0827402797 G -> A LOC_Os08g43360-LOC_Os08g43370 intergenic_region ; MODIFIER silent_mutation Average:84.414; most accessible tissue: Zhenshan97 panicle, score: 92.533 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0827402797 G A -0.01 0.0 0.01 0.0 0.0 0.0
vg0827402797 G C 0.0 0.01 0.03 0.0 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0827402797 NA 2.19E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827402797 NA 3.08E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827402797 NA 3.57E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827402797 NA 3.83E-37 mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827402797 4.04E-09 1.73E-50 mr1550 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827402797 NA 1.24E-06 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827402797 NA 3.35E-38 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827402797 NA 1.39E-31 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827402797 NA 2.82E-45 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827402797 NA 7.64E-27 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251