| Variant ID: vg0827235441 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr08 | Position: 27235441 |
| Reference Allele: T | Alternative Allele: A,TA |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAGAAATTTTAAATTCTATTATAGGATGATCAATTTGAGAATGAGAGAGTAATTTACTTAGACACTAATATTATAATATACGAATATAAGCAGTTTAAGT[T/A,TA]
TTTTTTTAAAGTCATCGGTGTTATATGACAACTCATATATGCATCATTCTTTTCTTTTACCGACATATCCTATATTGTCGATGTTTGATGCCGCGATTCC
GGAATCGCGGCATCAAACATCGACAATATAGGATATGTCGGTAAAAGAAAAGAATGATGCATATATGAGTTGTCATATAACACCGATGACTTTAAAAAAA[A/T,TA]
ACTTAAACTGCTTATATTCGTATATTATAATATTAGTGTCTAAGTAAATTACTCTCTCATTCTCAAATTGATCATCCTATAATAGAATTTAAAATTTCTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.80% | 34.30% | 0.13% | 2.98% | TA: 1.80% |
| All Indica | 2759 | 90.00% | 4.30% | 0.11% | 5.04% | TA: 0.47% |
| All Japonica | 1512 | 12.40% | 87.40% | 0.07% | 0.13% | NA |
| Aus | 269 | 58.00% | 17.50% | 0.00% | 0.00% | TA: 24.54% |
| Indica I | 595 | 90.40% | 8.70% | 0.17% | 0.67% | NA |
| Indica II | 465 | 77.00% | 0.60% | 0.00% | 22.37% | NA |
| Indica III | 913 | 95.70% | 2.70% | 0.22% | 0.66% | TA: 0.66% |
| Indica Intermediate | 786 | 90.80% | 5.10% | 0.00% | 3.18% | TA: 0.89% |
| Temperate Japonica | 767 | 6.80% | 93.10% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 7.10% | 92.70% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 41.50% | 58.10% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 2.10% | 92.70% | 0.00% | 0.00% | TA: 5.21% |
| Intermediate | 90 | 50.00% | 46.70% | 2.22% | 0.00% | TA: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0827235441 | T -> TA | LOC_Os08g43090.1 | upstream_gene_variant ; 1842.0bp to feature; MODIFIER | silent_mutation | Average:46.574; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0827235441 | T -> TA | LOC_Os08g43080-LOC_Os08g43090 | intergenic_region ; MODIFIER | silent_mutation | Average:46.574; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0827235441 | T -> A | LOC_Os08g43090.1 | upstream_gene_variant ; 1843.0bp to feature; MODIFIER | silent_mutation | Average:46.574; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0827235441 | T -> A | LOC_Os08g43080-LOC_Os08g43090 | intergenic_region ; MODIFIER | silent_mutation | Average:46.574; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0827235441 | T -> DEL | N | N | silent_mutation | Average:46.574; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0827235441 | NA | 8.38E-06 | mr1252 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827235441 | NA | 6.79E-07 | mr1544 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827235441 | NA | 2.79E-07 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |