Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0826497314:

Variant ID: vg0826497314 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 26497314
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, T: 0.07, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

TTACGATCTAGCTACGTTACAATTATATTATATCTGTTGATAAATGTATAGCAAAAGTGTTTTCCTACACTCACATAAAGAAAATTAAACCGAGCGTAAG[T/G]
ATTGGTGTGTGAGACGTGGTCGGATGCTAGTGGTACAGTTTGGTCGTACATATATAGCATGAGTAATATATAGTTGTAGTGTGGTGCCTGGTCGATCGGT

Reverse complement sequence

ACCGATCGACCAGGCACCACACTACAACTATATATTACTCATGCTATATATGTACGACCAAACTGTACCACTAGCATCCGACCACGTCTCACACACCAAT[A/C]
CTTACGCTCGGTTTAATTTTCTTTATGTGAGTGTAGGAAAACACTTTTGCTATACATTTATCAACAGATATAATATAATTGTAACGTAGCTAGATCGTAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.50%	23.40%	0.06%	0.04%	NA
All Indica	2759	99.20%	0.70%	0.07%	0.07%	NA
All Japonica	1512	39.70%	60.30%	0.07%	0.00%	NA
Aus	269	76.60%	23.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.60%	0.20%	0.11%	0.11%	NA
Indica Intermediate	786	98.00%	1.80%	0.13%	0.13%	NA
Temperate Japonica	767	8.70%	91.30%	0.00%	0.00%	NA
Tropical Japonica	504	80.80%	19.00%	0.20%	0.00%	NA
Japonica Intermediate	241	52.30%	47.70%	0.00%	0.00%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	70.00%	30.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0826497314	T -> G	LOC_Os08g41940.1	upstream_gene_variant ; 3853.0bp to feature; MODIFIER	silent_mutation	Average:84.316; most accessible tissue: Zhenshan97 panicle, score: 96.043	N	N	N	N
vg0826497314	T -> G	LOC_Os08g41930-LOC_Os08g41940	intergenic_region ; MODIFIER	silent_mutation	Average:84.316; most accessible tissue: Zhenshan97 panicle, score: 96.043	N	N	N	N
vg0826497314	T -> DEL	N	N	silent_mutation	Average:84.316; most accessible tissue: Zhenshan97 panicle, score: 96.043	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0826497314	T	G	0.12	0.05	0.05	0.04	0.04	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0826497314	NA	3.11E-10	mr1364	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826497314	NA	1.27E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826497314	NA	7.45E-06	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826497314	NA	7.13E-08	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826497314	NA	2.90E-09	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826497314	NA	7.42E-07	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826497314	NA	1.44E-07	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826497314	NA	1.21E-09	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826497314	NA	1.44E-07	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826497314	NA	3.85E-10	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826497314	NA	4.52E-08	mr1993	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826497314	NA	2.58E-39	mr1771_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826497314	NA	4.75E-08	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251