Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825885835:

Variant ID: vg0825885835 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 25885835
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAAAATTAGGAATTAAAAATAAGCAATATTGAAACAAGTTTTCATATAGGAACCCAATACGAGATTAATCAAGATTCAAAATAAAAATAAAATAAAATC[C/T]
AAAATTAGAAAAGGAAAGGAGAGTCCAAGTATAAATACAATTAAAAATAGCTGAAATTCAGAATTAAAAATAAGCAATGTTGAAAGAAGTTTTCATATAA

Reverse complement sequence

TTATATGAAAACTTCTTTCAACATTGCTTATTTTTAATTCTGAATTTCAGCTATTTTTAATTGTATTTATACTTGGACTCTCCTTTCCTTTTCTAATTTT[G/A]
GATTTTATTTTATTTTTATTTTGAATCTTGATTAATCTCGTATTGGGTTCCTATATGAAAACTTGTTTCAATATTGCTTATTTTTAATTCCTAATTTTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.90% 5.50% 1.57% 0.00% NA
All Indica  2759 94.60% 4.50% 0.87% 0.00% NA
All Japonica  1512 99.20% 0.30% 0.46% 0.00% NA
Aus  269 40.10% 45.00% 14.87% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 90.10% 8.50% 1.31% 0.00% NA
Indica Intermediate  786 92.90% 5.90% 1.27% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 96.30% 1.20% 2.49% 0.00% NA
VI/Aromatic  96 94.80% 4.20% 1.04% 0.00% NA
Intermediate  90 88.90% 8.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0825885835 C -> T LOC_Os08g40919.1 upstream_gene_variant ; 3659.0bp to feature; MODIFIER silent_mutation Average:20.755; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0825885835 C -> T LOC_Os08g40919.2 upstream_gene_variant ; 3659.0bp to feature; MODIFIER silent_mutation Average:20.755; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0825885835 C -> T LOC_Os08g40910.1 downstream_gene_variant ; 2395.0bp to feature; MODIFIER silent_mutation Average:20.755; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0825885835 C -> T LOC_Os08g40900-LOC_Os08g40910 intergenic_region ; MODIFIER silent_mutation Average:20.755; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0825885835 NA 1.16E-16 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 1.14E-06 2.74E-21 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 6.13E-06 1.63E-16 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 NA 2.21E-21 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 5.57E-06 NA mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 NA 2.14E-18 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 1.29E-07 2.17E-28 mr1123 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 NA 1.09E-06 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 NA 7.05E-17 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 6.38E-06 2.05E-19 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 NA 1.62E-21 mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 NA 4.44E-08 mr1348 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 NA 4.93E-08 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 3.26E-07 NA mr1495 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 6.50E-08 2.46E-21 mr1496 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 NA 4.30E-06 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 NA 4.93E-08 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 NA 6.30E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 NA 3.57E-07 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 NA 1.16E-19 mr1961 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 2.46E-06 1.08E-19 mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 1.22E-06 3.56E-19 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 2.71E-06 1.47E-21 mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 1.44E-06 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 3.60E-06 6.85E-20 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 NA 2.94E-22 mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 3.85E-06 7.41E-24 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 3.74E-06 2.56E-20 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 1.10E-06 NA mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 6.56E-06 8.68E-23 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825885835 2.69E-07 3.19E-17 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251