Variant ID: vg0825703185 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 25703185 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 263. )
CTGATAGCCAATACCTGATCCAGGGCAATAGTGGCAGATGATGAACTTTGGACAGTGTCAATGAAGAATGCTGAAGGATGCACTCGAATGGTAATGCGTC[A/G]
ATTAAGCAATTAGACAACACAAAAGATCGAATTCAGGCCCTATGGCTATCAGACATCAATAGGATAAAAATGATAATAAAAACTTCACACTCATTGCTAT
ATAGCAATGAGTGTGAAGTTTTTATTATCATTTTTATCCTATTGATGTCTGATAGCCATAGGGCCTGAATTCGATCTTTTGTGTTGTCTAATTGCTTAAT[T/C]
GACGCATTACCATTCGAGTGCATCCTTCAGCATTCTTCATTGACACTGTCCAAAGTTCATCATCTGCCACTATTGCCCTGGATCAGGTATTGGCTATCAG
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 92.10% | 7.10% | 0.78% | 0.00% | NA |
All Indica | 2759 | 99.40% | 0.10% | 0.47% | 0.00% | NA |
All Japonica | 1512 | 77.10% | 21.50% | 1.46% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 98.80% | 0.00% | 1.18% | 0.00% | NA |
Indica II | 465 | 99.10% | 0.00% | 0.86% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.50% | 0.30% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 95.20% | 4.60% | 0.26% | 0.00% | NA |
Tropical Japonica | 504 | 48.40% | 48.60% | 2.98% | 0.00% | NA |
Japonica Intermediate | 241 | 79.30% | 18.70% | 2.07% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 91.10% | 6.70% | 2.22% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0825703185 | A -> G | LOC_Os08g40600.1 | upstream_gene_variant ; 1562.0bp to feature; MODIFIER | silent_mutation | Average:70.003; most accessible tissue: Zhenshan97 young leaf, score: 84.624 | N | N | N | N |
vg0825703185 | A -> G | LOC_Os08g40615.1 | upstream_gene_variant ; 4509.0bp to feature; MODIFIER | silent_mutation | Average:70.003; most accessible tissue: Zhenshan97 young leaf, score: 84.624 | N | N | N | N |
vg0825703185 | A -> G | LOC_Os08g40590.2 | downstream_gene_variant ; 3546.0bp to feature; MODIFIER | silent_mutation | Average:70.003; most accessible tissue: Zhenshan97 young leaf, score: 84.624 | N | N | N | N |
vg0825703185 | A -> G | LOC_Os08g40590.1 | downstream_gene_variant ; 3546.0bp to feature; MODIFIER | silent_mutation | Average:70.003; most accessible tissue: Zhenshan97 young leaf, score: 84.624 | N | N | N | N |
vg0825703185 | A -> G | LOC_Os08g40610.1 | intron_variant ; MODIFIER | silent_mutation | Average:70.003; most accessible tissue: Zhenshan97 young leaf, score: 84.624 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0825703185 | NA | 7.93E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825703185 | NA | 8.30E-14 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825703185 | NA | 8.77E-06 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825703185 | 9.16E-06 | 1.46E-33 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825703185 | NA | 7.41E-17 | mr1699 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825703185 | 2.66E-07 | 3.05E-17 | mr1871 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825703185 | NA | 1.13E-07 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825703185 | NA | 2.19E-12 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825703185 | NA | 1.98E-14 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825703185 | NA | 1.15E-09 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |