Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825436815:

Variant ID: vg0825436815 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 25436815
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.02, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

CTGGATGTAACTGCAAGTTACTCCATCCATTCCAGGATACAAGACGTGATTTTAGTCAAAGTTAAATTATTTTAAATTTAACTAAGTTTATAGATAAATA[A/C]
AATAATATTTATAATACTAAATTAGTTTCGTCAAATCAATAATTGAATATATTTTCATAATAAATTTGTCTTGGGTTGAAAATGTTACTACTTTTTTCTA

Reverse complement sequence

TAGAAAAAAGTAGTAACATTTTCAACCCAAGACAAATTTATTATGAAAATATATTCAATTATTGATTTGACGAAACTAATTTAGTATTATAAATATTATT[T/G]
TATTTATCTATAAACTTAGTTAAATTTAAAATAATTTAACTTTGACTAAAATCACGTCTTGTATCCTGGAATGGATGGAGTAACTTGCAGTTACATCCAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.50%	46.30%	1.18%	0.06%	NA
All Indica	2759	56.80%	41.50%	1.67%	0.11%	NA
All Japonica	1512	39.80%	59.50%	0.66%	0.00%	NA
Aus	269	94.80%	5.20%	0.00%	0.00%	NA
Indica I	595	27.70%	72.30%	0.00%	0.00%	NA
Indica II	465	30.10%	64.10%	5.59%	0.22%	NA
Indica III	913	89.80%	8.80%	1.31%	0.11%	NA
Indica Intermediate	786	56.10%	42.70%	1.02%	0.13%	NA
Temperate Japonica	767	18.50%	80.70%	0.78%	0.00%	NA
Tropical Japonica	504	74.00%	25.40%	0.60%	0.00%	NA
Japonica Intermediate	241	36.10%	63.50%	0.41%	0.00%	NA
VI/Aromatic	96	8.30%	91.70%	0.00%	0.00%	NA
Intermediate	90	54.40%	45.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0825436815	A -> C	LOC_Os08g40200.1	upstream_gene_variant ; 282.0bp to feature; MODIFIER	silent_mutation	Average:65.557; most accessible tissue: Callus, score: 89.02	N	N	N	N
vg0825436815	A -> C	LOC_Os08g40190.1	downstream_gene_variant ; 481.0bp to feature; MODIFIER	silent_mutation	Average:65.557; most accessible tissue: Callus, score: 89.02	N	N	N	N
vg0825436815	A -> C	LOC_Os08g40210.1	downstream_gene_variant ; 4407.0bp to feature; MODIFIER	silent_mutation	Average:65.557; most accessible tissue: Callus, score: 89.02	N	N	N	N
vg0825436815	A -> C	LOC_Os08g40190-LOC_Os08g40200	intergenic_region ; MODIFIER	silent_mutation	Average:65.557; most accessible tissue: Callus, score: 89.02	N	N	N	N
vg0825436815	A -> DEL	N	N	silent_mutation	Average:65.557; most accessible tissue: Callus, score: 89.02	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0825436815	3.99E-06	4.50E-11	mr1993	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825436815	NA	2.24E-07	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251