Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825399481:

Variant ID: vg0825399481 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 25399481
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, C: 0.03, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

ATAGCTAGCTAGGTACGGTTGTTGTCTCTCTTGAGAATGATGCATGCCATCATATAGTGAGCTTCTGCTTGTCGATCTGCATGATGAAATGATATGAAAT[C/A]
TCGTGTGCATCTGCATGTACCTTTTAATCATCATCTGTCCTTGTACTGTACATTGCAGAAATCAGAAACATTTCAGACAGAAAAGTAGAATAGCAGCATG

Reverse complement sequence

CATGCTGCTATTCTACTTTTCTGTCTGAAATGTTTCTGATTTCTGCAATGTACAGTACAAGGACAGATGATGATTAAAAGGTACATGCAGATGCACACGA[G/T]
ATTTCATATCATTTCATCATGCAGATCGACAAGCAGAAGCTCACTATATGATGGCATGCATCATTCTCAAGAGAGACAACAACCGTACCTAGCTAGCTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.00%	31.50%	0.11%	0.34%	NA
All Indica	2759	56.30%	43.20%	0.14%	0.40%	NA
All Japonica	1512	98.70%	1.20%	0.00%	0.13%	NA
Aus	269	5.60%	94.10%	0.37%	0.00%	NA
Indica I	595	89.60%	10.30%	0.00%	0.17%	NA
Indica II	465	70.80%	28.60%	0.00%	0.65%	NA
Indica III	913	21.40%	77.80%	0.22%	0.66%	NA
Indica Intermediate	786	63.00%	36.60%	0.25%	0.13%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.20%	0.00%	0.40%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	73.30%	23.30%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0825399481	C -> A	LOC_Os08g40130.1	upstream_gene_variant ; 367.0bp to feature; MODIFIER	silent_mutation	Average:60.258; most accessible tissue: Callus, score: 86.988	N	N	N	N
vg0825399481	C -> A	LOC_Os08g40140.1	upstream_gene_variant ; 1767.0bp to feature; MODIFIER	silent_mutation	Average:60.258; most accessible tissue: Callus, score: 86.988	N	N	N	N
vg0825399481	C -> A	LOC_Os08g40140.2	upstream_gene_variant ; 1767.0bp to feature; MODIFIER	silent_mutation	Average:60.258; most accessible tissue: Callus, score: 86.988	N	N	N	N
vg0825399481	C -> A	LOC_Os08g40120.1	downstream_gene_variant ; 1849.0bp to feature; MODIFIER	silent_mutation	Average:60.258; most accessible tissue: Callus, score: 86.988	N	N	N	N
vg0825399481	C -> A	LOC_Os08g40120-LOC_Os08g40130	intergenic_region ; MODIFIER	silent_mutation	Average:60.258; most accessible tissue: Callus, score: 86.988	N	N	N	N
vg0825399481	C -> DEL	N	N	silent_mutation	Average:60.258; most accessible tissue: Callus, score: 86.988	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0825399481	NA	6.54E-11	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0825399481	NA	2.97E-16	Heading_date	Ind_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0825399481	NA	8.02E-06	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481	NA	1.81E-10	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481	NA	1.53E-08	mr1112	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481	NA	2.35E-07	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481	NA	9.68E-07	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481	NA	2.08E-06	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481	NA	1.05E-09	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481	NA	2.13E-06	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481	NA	9.34E-08	mr1218_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481	NA	2.89E-09	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481	NA	5.90E-09	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481	NA	3.36E-06	mr1511_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481	NA	6.70E-08	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481	NA	1.96E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481	NA	2.19E-06	mr1844_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825399481	NA	6.37E-08	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251