Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825217312:

Variant ID: vg0825217312 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 25217312
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, T: 0.05, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

GTCCAACTTCGGCCACCACGGGGCGTCCTTCTTGTCGCCGTGCCCCTTGGTGCGCACCTCGGTCCAGAACGCCTGGAGCTCCTCGTCGCCGGCGACGCTG[T/G]
CGGCGTCGGGGTAGAACCGCGCGACGTACGCCTGGACCCAGGTCTTGATGGCGTCCCAGATGAGGAGGCCGTCGTTGGCGAACGGGTAGTCCTCGATGGC

Reverse complement sequence

GCCATCGAGGACTACCCGTTCGCCAACGACGGCCTCCTCATCTGGGACGCCATCAAGACCTGGGTCCAGGCGTACGTCGCGCGGTTCTACCCCGACGCCG[A/C]
CAGCGTCGCCGGCGACGAGGAGCTCCAGGCGTTCTGGACCGAGGTGCGCACCAAGGGGCACGGCGACAAGAAGGACGCCCCGTGGTGGCCGAAGTTGGAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.60%	31.10%	0.04%	0.25%	NA
All Indica	2759	56.60%	43.00%	0.00%	0.40%	NA
All Japonica	1512	99.50%	0.50%	0.07%	0.00%	NA
Aus	269	6.70%	93.30%	0.00%	0.00%	NA
Indica I	595	65.40%	34.10%	0.00%	0.50%	NA
Indica II	465	75.70%	24.10%	0.00%	0.22%	NA
Indica III	913	39.20%	60.70%	0.00%	0.11%	NA
Indica Intermediate	786	58.80%	40.50%	0.00%	0.76%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	76.70%	21.10%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0825217312	T -> G	LOC_Os08g39840.1	missense_variant ; p.Asp720Ala; MODERATE	nonsynonymous_codon ; D720A	Average:64.91; most accessible tissue: Minghui63 young leaf, score: 95.091	unknown	unknown	TOLERATED	0.37
vg0825217312	T -> DEL	LOC_Os08g39840.1	N	frameshift_variant	Average:64.91; most accessible tissue: Minghui63 young leaf, score: 95.091	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0825217312	T	G	0.0	0.01	-0.01	0.0	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0825217312	NA	6.56E-07	mr1545	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825217312	NA	1.74E-06	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825217312	9.41E-06	NA	mr1699	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825217312	NA	2.87E-07	mr1699	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825217312	1.06E-21	3.29E-45	mr1874	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825217312	4.41E-20	3.20E-26	mr1874	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825217312	NA	6.98E-18	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825217312	1.35E-06	NA	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825217312	3.00E-06	5.52E-09	mr1699_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825217312	1.05E-19	7.82E-61	mr1874_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825217312	2.50E-17	1.71E-30	mr1874_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251